Incidental Mutation 'R0683:Gm6768'
ID61055
Institutional Source Beutler Lab
Gene Symbol Gm6768
Ensembl Gene ENSMUSG00000021908
Gene Namepredicted gene 6768
Synonyms
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R0683 (G1)
Quality Score115
Status Not validated
Chromosome12
Chromosomal Location119260934-119264272 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 119261078 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000022467
SMART Domains Protein: ENSMUSP00000136708
Gene: ENSMUSG00000021908

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Exoc8 A G 8: 124,895,633 I665T probably damaging Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Maml3 G A 3: 51,856,752 Q264* probably null Het
Neu1 A T 17: 34,934,325 probably null Het
Nrp2 A G 1: 62,744,318 T193A probably benign Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Serpinb13 A G 1: 106,999,021 N249S probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Zfp763 G A 17: 33,018,918 P418S probably damaging Het
Other mutations in Gm6768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Gm6768 APN 12 119262496 exon noncoding transcript
R1186:Gm6768 UTSW 12 119261471 exon noncoding transcript
R1485:Gm6768 UTSW 12 119261050 exon noncoding transcript
R1708:Gm6768 UTSW 12 119262233 exon noncoding transcript
R1800:Gm6768 UTSW 12 119261771 exon noncoding transcript
R2280:Gm6768 UTSW 12 119262838 exon noncoding transcript
R4827:Gm6768 UTSW 12 119261794 exon noncoding transcript
R4922:Gm6768 UTSW 12 119262517 exon noncoding transcript
R5183:Gm6768 UTSW 12 119261288 exon noncoding transcript
R5562:Gm6768 UTSW 12 119262222 exon noncoding transcript
R5752:Gm6768 UTSW 12 119262614 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6084:Gm6768 UTSW 12 119261651 exon noncoding transcript
R6151:Gm6768 UTSW 12 119261106 exon noncoding transcript
X0024:Gm6768 UTSW 12 119261684 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTCTCCCTGCCAGTGCAGAAC -3'
(R):5'- CATTAGCCAATAGAGCTGCTGAGCC -3'

Sequencing Primer
(F):5'- gtctcggtctattcctctactac -3'
(R):5'- TGCTGAGCCTGCTGCTG -3'
Posted On2013-07-30