Incidental Mutation 'R7912:Ttc17'
ID 610562
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Name tetratricopeptide repeat domain 17
Synonyms D2Bwg1005e, 9130020K17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock # R7912 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 94300767-94406689 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94378821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 96 (N96I)
Ref Sequence ENSEMBL: ENSMUSP00000106869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
AlphaFold E9PVB5
Predicted Effect probably damaging
Transcript: ENSMUST00000094801
AA Change: N96I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: N96I

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111237
AA Change: N96I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: N96I

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111238
AA Change: N96I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: N96I

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94323083 splice site probably benign
IGL00870:Ttc17 APN 2 94371733 splice site probably null
IGL01120:Ttc17 APN 2 94371796 missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94332832 nonsense probably null
IGL01895:Ttc17 APN 2 94375146 missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94330667 missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94377710 missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94342661 missense probably benign
IGL02456:Ttc17 APN 2 94362785 splice site probably benign
IGL02475:Ttc17 APN 2 94364376 missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94375221 missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94386105 missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0443:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0511:Ttc17 UTSW 2 94323120 missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94332803 missense probably benign 0.08
R1980:Ttc17 UTSW 2 94326704 missense probably benign 0.14
R1981:Ttc17 UTSW 2 94326704 missense probably benign 0.14
R1987:Ttc17 UTSW 2 94364345 missense probably benign
R2064:Ttc17 UTSW 2 94366547 missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94301794 missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94366642 missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94376074 nonsense probably null
R3719:Ttc17 UTSW 2 94364327 missense probably benign 0.27
R3852:Ttc17 UTSW 2 94369413 missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94376146 splice site probably benign
R4411:Ttc17 UTSW 2 94342753 missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94366571 missense probably benign 0.02
R4660:Ttc17 UTSW 2 94364429 missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94371768 missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94332891 missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94364610 missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94366635 missense probably benign 0.01
R4870:Ttc17 UTSW 2 94366609 missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94303560 missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94377682 missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94362521 missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94378848 missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94358755 missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94303546 missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94386102 missense probably benign 0.02
R7204:Ttc17 UTSW 2 94362428 missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94375134 missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94375150 missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94366544 missense probably benign 0.06
R8083:Ttc17 UTSW 2 94374564 missense probably damaging 1.00
R8304:Ttc17 UTSW 2 94369181 intron probably benign
R8381:Ttc17 UTSW 2 94301821 missense probably damaging 1.00
R8512:Ttc17 UTSW 2 94371763 missense probably damaging 1.00
R8737:Ttc17 UTSW 2 94376029 critical splice donor site probably null
R8850:Ttc17 UTSW 2 94406658 missense possibly damaging 0.55
R8886:Ttc17 UTSW 2 94375128 missense probably benign 0.19
R8888:Ttc17 UTSW 2 94326704 missense probably benign 0.14
R8891:Ttc17 UTSW 2 94362419 missense probably damaging 1.00
R9336:Ttc17 UTSW 2 94358853 missense probably benign 0.00
R9600:Ttc17 UTSW 2 94374545 missense probably damaging 1.00
R9632:Ttc17 UTSW 2 94378752 missense probably damaging 1.00
R9642:Ttc17 UTSW 2 94364390 missense probably benign 0.00
R9657:Ttc17 UTSW 2 94406665 start codon destroyed probably benign 0.02
X0013:Ttc17 UTSW 2 94330670 missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94324516 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGCTAATTGGTTTGCAAGCTTTC -3'
(R):5'- TGGTAGTTGAAAAGCAGCTTG -3'

Sequencing Primer
(F):5'- CCCATCGGTGATGAAACATTG -3'
(R):5'- AAGCAGCTTGTCGGAAGTTC -3'
Posted On 2019-12-20