Incidental Mutation 'R7912:Fastkd5'
ID610563
Institutional Source Beutler Lab
Gene Symbol Fastkd5
Ensembl Gene ENSMUSG00000079043
Gene NameFAST kinase domains 5
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130613840-130630027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130616637 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 11 (G11D)
Ref Sequence ENSEMBL: ENSMUSP00000105891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000110262] [ENSMUST00000140581] [ENSMUST00000179273]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110262
AA Change: G11D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043
AA Change: G11D

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140581
AA Change: G11D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300
AA Change: G11D

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179273
AA Change: G11D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137385
Gene: ENSMUSG00000079043
AA Change: G11D

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 1.5e-26 PFAM
Pfam:FAST_2 553 646 4.4e-29 PFAM
RAP 742 801 6.92e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Fastkd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Fastkd5 APN 2 130616377 missense probably benign 0.14
IGL01148:Fastkd5 APN 2 130614685 missense probably benign
IGL01765:Fastkd5 APN 2 130615734 missense possibly damaging 0.95
IGL01806:Fastkd5 APN 2 130615612 missense probably benign 0.02
IGL02266:Fastkd5 APN 2 130615561 missense probably damaging 1.00
IGL02879:Fastkd5 APN 2 130614421 missense probably damaging 0.97
R0504:Fastkd5 UTSW 2 130615917 missense probably benign 0.08
R0544:Fastkd5 UTSW 2 130615296 missense probably damaging 1.00
R1140:Fastkd5 UTSW 2 130616215 missense probably benign 0.00
R1459:Fastkd5 UTSW 2 130614797 missense probably damaging 0.97
R1770:Fastkd5 UTSW 2 130614280 missense probably damaging 1.00
R2519:Fastkd5 UTSW 2 130616194 missense possibly damaging 0.56
R2566:Fastkd5 UTSW 2 130616365 missense probably benign 0.00
R3080:Fastkd5 UTSW 2 130615453 missense possibly damaging 0.89
R4496:Fastkd5 UTSW 2 130616581 missense probably benign 0.01
R5566:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6516:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6993:Fastkd5 UTSW 2 130616539 missense probably benign
R7032:Fastkd5 UTSW 2 130615944 missense possibly damaging 0.92
R7049:Fastkd5 UTSW 2 130615511 missense probably damaging 1.00
R7051:Fastkd5 UTSW 2 130614417 missense probably damaging 1.00
R7331:Fastkd5 UTSW 2 130615727 missense possibly damaging 0.79
R7348:Fastkd5 UTSW 2 130615135 missense probably damaging 1.00
R7348:Fastkd5 UTSW 2 130616439 missense probably benign 0.00
R7524:Fastkd5 UTSW 2 130616128 missense probably benign 0.41
R7603:Fastkd5 UTSW 2 130615041 missense possibly damaging 0.95
R7657:Fastkd5 UTSW 2 130616256 missense probably benign 0.00
R7745:Fastkd5 UTSW 2 130615068 missense probably damaging 1.00
R8140:Fastkd5 UTSW 2 130615250 missense possibly damaging 0.89
X0018:Fastkd5 UTSW 2 130616612 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCACGGTAAGCAGGATTAC -3'
(R):5'- TCTGGGCATTCACTAACACTGC -3'

Sequencing Primer
(F):5'- AGCAGGATTACAAGGTGCTTTGTAC -3'
(R):5'- CAATTCTGGCCCCATCA -3'
Posted On2019-12-20