Incidental Mutation 'R0683:Zfp763'
Institutional Source Beutler Lab
Gene Symbol Zfp763
Ensembl Gene ENSMUSG00000067430
Gene Namezinc finger protein 763
MMRRC Submission 038868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0683 (G1)
Quality Score164
Status Not validated
Chromosomal Location33016863-33033402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33018918 bp
Amino Acid Change Proline to Serine at position 418 (P418S)
Ref Sequence ENSEMBL: ENSMUSP00000084936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087654]
Predicted Effect probably damaging
Transcript: ENSMUST00000087654
AA Change: P418S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084936
Gene: ENSMUSG00000067430
AA Change: P418S

KRAB 10 60 7.47e-14 SMART
ZnF_C2H2 223 245 2.53e-2 SMART
ZnF_C2H2 251 273 4.54e-4 SMART
ZnF_C2H2 279 301 1.69e-3 SMART
ZnF_C2H2 307 329 5.72e-1 SMART
ZnF_C2H2 335 357 1.64e-1 SMART
ZnF_C2H2 363 385 1.56e-2 SMART
ZnF_C2H2 391 413 1.82e-3 SMART
ZnF_C2H2 419 441 1.64e-1 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
ZnF_C2H2 475 497 2.02e-1 SMART
ZnF_C2H2 503 525 7.15e-2 SMART
ZnF_C2H2 531 553 1.79e-2 SMART
ZnF_C2H2 559 581 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124465
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
Atg16l2 T C 7: 101,290,384 D533G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Eif3i G T 4: 129,593,535 N162K probably benign Het
Exoc8 A G 8: 124,895,633 I665T probably damaging Het
Ggt7 A G 2: 155,506,508 S75P probably benign Het
Gjc1 A T 11: 102,800,411 F255L probably benign Het
Gm6768 T C 12: 119,261,078 noncoding transcript Het
Krt1 A G 15: 101,850,466 F88L unknown Het
Maml3 G A 3: 51,856,752 Q264* probably null Het
Neu1 A T 17: 34,934,325 probably null Het
Nrp2 A G 1: 62,744,318 T193A probably benign Het
Olfr1255 C G 2: 89,817,178 P278R probably damaging Het
P4ha1 A G 10: 59,337,147 T23A probably benign Het
Pgm2 A G 4: 99,961,543 I112V probably damaging Het
Ptprs A T 17: 56,414,086 V1385D probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Serpinb13 A G 1: 106,999,021 N249S probably damaging Het
Sh3pxd2a T C 19: 47,267,511 T923A probably benign Het
Speg G A 1: 75,429,118 A2989T probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tcp11l1 A T 2: 104,681,892 V465E possibly damaging Het
Ttn G A 2: 76,938,309 T2973I unknown Het
Vav3 C A 3: 109,651,813 Q110K probably benign Het
Xcr1 T C 9: 123,855,875 D274G probably benign Het
Other mutations in Zfp763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Zfp763 APN 17 33019934 missense probably benign 0.41
IGL03291:Zfp763 APN 17 33019886 missense probably damaging 0.96
R0346:Zfp763 UTSW 17 33019747 missense probably benign 0.26
R0675:Zfp763 UTSW 17 33019800 missense possibly damaging 0.92
R1494:Zfp763 UTSW 17 33021503 missense probably damaging 0.99
R1521:Zfp763 UTSW 17 33033302 start codon destroyed probably benign 0.03
R1607:Zfp763 UTSW 17 33019907 missense probably benign 0.08
R1627:Zfp763 UTSW 17 33021784 missense probably damaging 1.00
R1714:Zfp763 UTSW 17 33019617 missense probably damaging 0.99
R1993:Zfp763 UTSW 17 33018439 missense probably damaging 1.00
R2109:Zfp763 UTSW 17 33019778 missense probably benign
R4420:Zfp763 UTSW 17 33018481 missense probably benign 0.43
R4612:Zfp763 UTSW 17 33018948 missense probably benign 0.05
R5114:Zfp763 UTSW 17 33018975 missense probably damaging 0.99
R5426:Zfp763 UTSW 17 33019595 missense probably benign
R5503:Zfp763 UTSW 17 33019533 missense possibly damaging 0.95
R5534:Zfp763 UTSW 17 33021794 missense probably damaging 0.97
R6133:Zfp763 UTSW 17 33018701 missense possibly damaging 0.75
R7141:Zfp763 UTSW 17 33018795 missense probably damaging 0.97
R7365:Zfp763 UTSW 17 33033378 start gained probably benign
R7430:Zfp763 UTSW 17 33019532 missense possibly damaging 0.68
R7552:Zfp763 UTSW 17 33018651 missense probably benign
R8277:Zfp763 UTSW 17 33033320 start gained probably benign
R8446:Zfp763 UTSW 17 33019499 missense probably benign 0.28
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gctttcccacattttttacacac -3'
(R):5'- gtgtaagcagtgtggcaaag -3'
Posted On2013-07-30