Incidental Mutation 'R7912:Gimap8'
ID610586
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48651065 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 252 (C252F)
Ref Sequence ENSEMBL: ENSMUSP00000145286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078223
AA Change: C252F

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262
AA Change: C252F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203083
AA Change: C252F

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: C252F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203509
AA Change: C252F

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: C252F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R2938:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R3147:Gimap8 UTSW 6 48650506 missense probably damaging 1.00
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5091:Gimap8 UTSW 6 48656647 missense possibly damaging 0.91
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6221:Gimap8 UTSW 6 48658942 missense probably damaging 1.00
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7154:Gimap8 UTSW 6 48656188 missense probably damaging 1.00
R7666:Gimap8 UTSW 6 48659155 missense probably damaging 1.00
R7686:Gimap8 UTSW 6 48656072 missense probably damaging 0.99
R7993:Gimap8 UTSW 6 48651065 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTAGCTTGCATGATTACCACAGC -3'
(R):5'- TCTGACGGCTGCTTCTGTAC -3'

Sequencing Primer
(F):5'- GCATGATTACCACAGCATCTTCTG -3'
(R):5'- TGTACCGATTCACACATGTCAGGAG -3'
Posted On2019-12-20