Incidental Mutation 'R7912:Itfg1'
ID610597
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85764280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 340 (D340G)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably damaging
Transcript: ENSMUST00000034140
AA Change: D340G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: D340G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCATGGGATGAGTTCAC -3'
(R):5'- ATCGTTCCTTTTGCAAATGGTGAC -3'

Sequencing Primer
(F):5'- CCATGGGATGAGTTCACCGATTAC -3'
(R):5'- GTTCCTGTGCTTCAGGAT -3'
Posted On2019-12-20