Incidental Mutation 'R7912:Hydin'
ID610599
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110555607 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 3113 (R3113L)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043141
AA Change: R3113L

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: R3113L

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
Franz_joseph UTSW 8 110601318 missense probably damaging 1.00
maria UTSW 8 110509127 splice site probably benign
teresa UTSW 8 110609671 missense possibly damaging 0.79
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6980:Hydin UTSW 8 110413284 missense possibly damaging 0.91
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
R7061:Hydin UTSW 8 110603288 missense possibly damaging 0.90
R7085:Hydin UTSW 8 110603330 missense probably benign 0.03
R7086:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R7110:Hydin UTSW 8 110354951 critical splice acceptor site probably null
R7158:Hydin UTSW 8 110609671 missense possibly damaging 0.79
R7163:Hydin UTSW 8 110603336 missense probably benign 0.25
R7209:Hydin UTSW 8 110489792 nonsense probably null
R7244:Hydin UTSW 8 110549675 missense probably damaging 0.98
R7347:Hydin UTSW 8 110600362 missense probably benign 0.06
R7349:Hydin UTSW 8 110398171 splice site probably null
R7359:Hydin UTSW 8 110506101 missense probably damaging 0.98
R7365:Hydin UTSW 8 110557662 missense probably damaging 0.99
R7365:Hydin UTSW 8 110601273 missense probably damaging 1.00
R7436:Hydin UTSW 8 110583914 missense probably damaging 0.96
R7528:Hydin UTSW 8 110380572 nonsense probably null
R7544:Hydin UTSW 8 110589525 missense probably benign 0.35
R7625:Hydin UTSW 8 110541844 missense probably benign 0.01
R7713:Hydin UTSW 8 110593812 missense possibly damaging 0.69
R7763:Hydin UTSW 8 110505843 missense possibly damaging 0.92
R7771:Hydin UTSW 8 110565085 missense probably damaging 0.97
R7794:Hydin UTSW 8 110509083 missense probably damaging 1.00
R7894:Hydin UTSW 8 110513010 missense possibly damaging 0.88
R7899:Hydin UTSW 8 110587748 missense probably benign 0.00
R7908:Hydin UTSW 8 110510867 missense probably benign 0.01
R7916:Hydin UTSW 8 110589460 missense probably damaging 0.99
R7977:Hydin UTSW 8 110513010 missense possibly damaging 0.88
R7982:Hydin UTSW 8 110587748 missense probably benign 0.00
R7989:Hydin UTSW 8 110510867 missense probably benign 0.01
R7993:Hydin UTSW 8 110555607 missense possibly damaging 0.68
R8011:Hydin UTSW 8 110583909 missense probably damaging 1.00
R8041:Hydin UTSW 8 110574994 missense probably benign 0.02
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Z1176:Hydin UTSW 8 110541600 missense possibly damaging 0.65
Z1177:Hydin UTSW 8 110380610 missense probably damaging 1.00
Z1177:Hydin UTSW 8 110450232 missense possibly damaging 0.47
Z1177:Hydin UTSW 8 110587142 frame shift probably null
Z1177:Hydin UTSW 8 110609989 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCTTCGTCAAAAGAGTTTCCAGAAAAG -3'
(R):5'- TCATCCTCGGATTCCAGGGAAC -3'

Sequencing Primer
(F):5'- GTTCCCTAAAGTCATCATTGTGG -3'
(R):5'- AACTGAGTGGGGTGTTTCAC -3'
Posted On2019-12-20