Incidental Mutation 'R7912:Trank1'
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111391528 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 2444 (D2444E)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: D2444E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: D2444E

low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
St13 T C 15: 81,399,518 E26G possibly damaging Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
R8829:Trank1 UTSW 9 111347523 missense probably benign
R8838:Trank1 UTSW 9 111364905 missense probably benign 0.03
R8855:Trank1 UTSW 9 111312221 missense unknown
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-20