Incidental Mutation 'R7912:St13'
ID610627
Institutional Source Beutler Lab
Gene Symbol St13
Ensembl Gene ENSMUSG00000022403
Gene Namesuppression of tumorigenicity 13
SynonymsHsp70 interacting protein, HSPABP1, PRO0786, 1110007I03Rik, 3110002K08Rik, SNC6, p48
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R7912 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81363669-81400077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81399518 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 26 (E26G)
Ref Sequence ENSEMBL: ENSMUSP00000130195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000041609] [ENSMUST00000163382] [ENSMUST00000163754] [ENSMUST00000165258] [ENSMUST00000165582] [ENSMUST00000169204] [ENSMUST00000172107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023039
AA Change: E26G

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403
AA Change: E26G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041609
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163382
AA Change: E26G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131502
Gene: ENSMUSG00000022403
AA Change: E26G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 2e-27 PDB
low complexity region 52 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163754
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Predicted Effect probably benign
Transcript: ENSMUST00000165582
SMART Domains Protein: ENSMUSP00000129966
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
Pfam:TPR_11 74 129 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169204
Predicted Effect possibly damaging
Transcript: ENSMUST00000172107
AA Change: E26G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403
AA Change: E26G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,515 I497K probably damaging Het
2310003L06Rik A G 5: 87,972,592 T403A probably benign Het
4932438A13Rik C T 3: 37,007,069 A3309V probably damaging Het
5730559C18Rik A G 1: 136,227,541 S109P probably benign Het
Aco1 T C 4: 40,184,983 L551S probably damaging Het
Acvr1 C T 2: 58,474,218 V200I probably damaging Het
Adam26b T A 8: 43,520,208 T586S probably benign Het
Ahctf1 T C 1: 179,753,091 R1849G probably benign Het
Alox5 T A 6: 116,412,536 D590V probably benign Het
Anapc5 A G 5: 122,793,435 probably null Het
Anln T C 9: 22,358,669 E743G possibly damaging Het
Anpep T C 7: 79,838,426 K496R probably benign Het
Aox3 T A 1: 58,142,696 S281T probably benign Het
Arhgef11 C A 3: 87,733,222 P1258T probably damaging Het
Atp2c2 A T 8: 119,730,178 D173V possibly damaging Het
Aurka T G 2: 172,369,029 D22A probably benign Het
B3gat1 A T 9: 26,755,586 D51V probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTG CACTGATTCTGTGGTGACTG 3: 95,888,138 probably benign Het
BC028528 CTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA CTGGTTCTGTGGTCAATGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCA 3: 95,888,140 probably benign Het
BC028528 GGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT GGTTCTGTGGTCACTTGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACT 3: 95,888,142 probably benign Het
BC028528 TTC TTCGGTGGTCACTGGCTC 3: 95,888,144 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCAC 3: 95,888,171 probably benign Het
Bcas3 G A 11: 85,371,128 G96S probably damaging Het
C2cd4d T A 3: 94,363,553 V42D probably damaging Het
Ccdc127 T C 13: 74,357,032 L233P probably damaging Het
Cdc42bpa A G 1: 180,094,013 K573E probably damaging Het
Cend1 T C 7: 141,427,631 D92G probably damaging Het
Crb1 T C 1: 139,243,171 D827G probably damaging Het
Cyld G T 8: 88,734,897 C654F probably damaging Het
Fastkd5 C T 2: 130,616,637 G11D probably damaging Het
Foxj3 A T 4: 119,620,055 N354I possibly damaging Het
Gimap8 G T 6: 48,651,065 C252F probably benign Het
Glra1 T C 11: 55,520,995 Y329C probably damaging Het
Gm10330 G A 12: 23,779,979 P67L probably benign Het
Gpm6a T C 8: 55,055,434 I226T possibly damaging Het
Gstt2 A G 10: 75,832,584 F121S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn2 T C 2: 31,420,299 F3302L probably benign Het
Hormad2 T C 11: 4,408,841 T189A probably damaging Het
Hps5 A T 7: 46,769,402 S815T probably benign Het
Hydin G T 8: 110,555,607 R3113L possibly damaging Het
Inpp5f T A 7: 128,692,313 C698S probably benign Het
Irs1 T G 1: 82,289,884 M204L probably benign Het
Itfg1 T C 8: 85,764,280 D340G probably damaging Het
Itm2c T A 1: 85,905,311 I122N probably damaging Het
Lamp3 T A 16: 19,655,497 T376S probably damaging Het
Lrba T A 3: 86,715,565 I2418N probably damaging Het
Lrcol1 T A 5: 110,354,849 V161D probably damaging Het
Lrp2 T A 2: 69,428,672 Q4558L probably benign Het
Lrrfip2 A T 9: 111,205,768 Q175L probably damaging Het
Mib1 T G 18: 10,778,187 S572R probably damaging Het
Mis18bp1 A T 12: 65,152,758 D456E possibly damaging Het
Mlh1 T A 9: 111,261,513 T116S possibly damaging Het
Mpp4 T C 1: 59,121,362 N594S probably damaging Het
Nbas A G 12: 13,405,457 E1224G possibly damaging Het
Neb T C 2: 52,220,985 D163G possibly damaging Het
Nectin4 T C 1: 171,380,373 V111A possibly damaging Het
Nfatc2ip G A 7: 126,390,445 R256* probably null Het
Nlgn2 G A 11: 69,825,934 R594C probably damaging Het
Nufip1 A G 14: 76,115,002 S198G possibly damaging Het
Olfr134 T C 17: 38,175,267 F61S probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr281 C T 15: 98,456,693 H128Y probably benign Het
Olfr913 T C 9: 38,595,150 F310L probably benign Het
Pcdhga8 G A 18: 37,726,843 M317I probably benign Het
Phactr1 A T 13: 42,709,763 I55L probably benign Het
Prl3c1 G A 13: 27,199,384 R31Q probably benign Het
Prss55 A T 14: 64,081,731 F59Y possibly damaging Het
Ptprb T C 10: 116,322,487 W488R probably damaging Het
Qrich2 GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC GAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGCCCCAGGCTGCAACAAACCAGGCTGATCTGTCCCAGGCTGCAACAAACCAGGCTGATC 11: 116,455,782 probably benign Het
Ros1 G T 10: 52,168,695 T172K probably damaging Het
Rtel1 C T 2: 181,356,076 R1206W possibly damaging Het
Slf2 A T 19: 44,942,243 K586N probably damaging Het
Smc2 T A 4: 52,450,854 M224K probably benign Het
Spinkl T C 18: 44,166,649 Y83C probably damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Teddm3 T A 16: 21,152,949 Q290L probably benign Het
Tfec C A 6: 16,840,468 probably null Het
Trank1 C A 9: 111,391,528 D2444E probably benign Het
Ttc17 T A 2: 94,378,821 N96I probably damaging Het
Ttn T C 2: 76,729,786 T29424A possibly damaging Het
Vmn1r68 G A 7: 10,527,310 T287I probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r92 A T 17: 18,184,708 T705S possibly damaging Het
Vps13d T C 4: 145,173,127 D200G Het
Wdr48 G A 9: 119,904,339 C84Y probably damaging Het
Zcchc6 C A 13: 59,799,005 Q1003H probably damaging Het
Zscan25 T A 5: 145,290,511 H328Q probably benign Het
Other mutations in St13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:St13 APN 15 81371507 missense probably damaging 0.99
IGL01933:St13 APN 15 81389698 critical splice acceptor site probably null
IGL02152:St13 APN 15 81366382 missense probably damaging 1.00
R0714:St13 UTSW 15 81383027 missense probably benign 0.16
R3417:St13 UTSW 15 81369450 splice site probably benign
R4845:St13 UTSW 15 81399585 missense probably benign 0.09
R4925:St13 UTSW 15 81399585 missense probably benign 0.09
R4934:St13 UTSW 15 81399585 missense probably benign 0.09
R5029:St13 UTSW 15 81399585 missense probably benign 0.09
R5042:St13 UTSW 15 81365492 missense probably damaging 1.00
R5048:St13 UTSW 15 81399585 missense probably benign 0.09
R5139:St13 UTSW 15 81399585 missense probably benign 0.09
R5970:St13 UTSW 15 81377798 missense probably damaging 0.99
R6158:St13 UTSW 15 81399601 splice site probably null
R6175:St13 UTSW 15 81399305 critical splice donor site probably null
R6872:St13 UTSW 15 81366346 critical splice donor site probably null
R7320:St13 UTSW 15 81389653 missense probably damaging 0.99
X0065:St13 UTSW 15 81366436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGTTGCCCAACGCTCCAG -3'
(R):5'- ACGGGCAGCTACACTTCTAG -3'

Sequencing Primer
(F):5'- GATCCCTCCGAGAACCTCTC -3'
(R):5'- GGCAGCTACACTTCTAGAAGGTTC -3'
Posted On2019-12-20