Mutagenetix > Incidental Mutation

Incidental Mutation 'R7913:Pik3c2b'

610639

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7913 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 133090061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	A	G	10: 91,060,271	V324A	probably damaging	Het
Aqp8	T	A	7: 123,464,272	I115N	possibly damaging	Het
Atrn	G	A	2: 130,970,211	C692Y	probably damaging	Het
Card10	A	T	15: 78,781,103	S717T	possibly damaging	Het
Cep78	T	C	19: 15,970,577	S408G	probably benign	Het
Col24a1	G	T	3: 145,431,866	G895*	probably null	Het
Cs	A	T	10: 128,350,441	K34N	possibly damaging	Het
Dchs1	T	C	7: 105,759,228	E1799G	possibly damaging	Het
Dlg5	A	T	14: 24,137,124		probably null	Het
Dpy19l4	A	T	4: 11,265,859	Y696*	probably null	Het
Dync1h1	A	T	12: 110,628,734	N1360I	probably benign	Het
Fgd2	G	T	17: 29,374,045	R423L	probably damaging	Het
Fmo4	T	C	1: 162,794,172	D490G	possibly damaging	Het
Gm13083	T	A	4: 143,615,045	Y15N	possibly damaging	Het
Gm5113	A	T	7: 30,178,223		probably benign	Het
Grid1	T	A	14: 35,569,697	W854R	probably damaging	Het
H2-M1	T	C	17: 36,670,237		probably null	Het
Hivep1	T	A	13: 42,156,366	M694K	probably benign	Het
Hsd17b6	T	C	10: 127,997,776	T79A	possibly damaging	Het
Hspa4	A	C	11: 53,262,307	V761G	probably benign	Het
Ifi203	T	C	1: 173,926,957	Y736C	probably damaging	Het
Mettl9	T	A	7: 121,076,301	L308Q	probably damaging	Het
Miox	A	G	15: 89,336,582	D230G	probably damaging	Het
Ncapd3	T	A	9: 27,048,226	C319*	probably null	Het
Ncs1	C	A	2: 31,287,284		probably null	Het
Nell1	T	A	7: 50,279,522	H392Q	possibly damaging	Het
Nlrp1b	C	A	11: 71,217,711	E321D	possibly damaging	Het
Nlrp9b	A	T	7: 20,045,800	H796L	probably benign	Het
Nudt16l1	C	A	16: 4,939,381	Q53K	possibly damaging	Het
Nyap1	A	G	5: 137,734,969	S601P	probably damaging	Het
Odf2l	C	T	3: 145,153,483	Q634*	probably null	Het
Olfr1023	T	A	2: 85,887,730	L310H	probably damaging	Het
Olfr1150-ps1	A	G	2: 87,846,693	I141V	probably benign	Het
Olfr118	A	T	17: 37,672,108	E28D	probably benign	Het
Olfr1477	T	A	19: 13,503,207	V288E	probably damaging	Het
Olfr205	C	T	16: 59,329,243	D89N	possibly damaging	Het
Olfr381	A	G	11: 73,486,398	V142A	probably benign	Het
Peg3	GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC	GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC	7: 6,709,168		probably benign	Het
Prl3c1	A	G	13: 27,199,410	I40V	probably benign	Het
R3hdm4	C	T	10: 79,911,945	A229T	probably damaging	Het
Rab3gap2	T	C	1: 185,262,816	S851P	possibly damaging	Het
Ralgapb	A	T	2: 158,465,939	I1056F	probably damaging	Het
Sec16b	T	C	1: 157,529,329	Y36H	probably benign	Het
Setd3	A	T	12: 108,107,665	V451D	probably benign	Het
Slc35e1	T	C	8: 72,484,662	K334R	probably damaging	Het
Synj1	A	T	16: 90,991,427	N184K	possibly damaging	Het
Syt1	T	C	10: 108,642,248	D105G	probably benign	Het
Taar7e	T	A	10: 24,038,004	C131S	possibly damaging	Het
Tead4	A	G	6: 128,243,368		probably null	Het
Tescl	C	A	7: 24,333,651	R83L	probably damaging	Het
Ufd1	G	T	16: 18,814,866	V14F	probably benign	Het
Ugt1a10	T	A	1: 88,055,755	Y92N	probably benign	Het
Vmn2r52	C	A	7: 10,162,950	V532L	probably benign	Het
Vmn2r67	G	A	7: 85,151,828	T300I	possibly damaging	Het
Wt1	T	G	2: 105,166,860	S381A	probably damaging	Het
Zbtb44	C	T	9: 31,054,208	Q305*	probably null	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGGAGAGATGCAGATCTTG -3'
(R):5'- TCAGAGATGGCTCGTTTCAG -3'

Sequencing Primer
(F):5'- GGGGATGACATTTCCTGCTC -3'
(R):5'- CTCGTTTCAGGAGAAAGCGCAC -3'

Posted On

2019-12-20