Incidental Mutation 'R7913:Pik3c2b'
ID 610639
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 045961-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R7913 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 133017799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 90,896,133 (GRCm39) V324A probably damaging Het
Aqp8 T A 7: 123,063,495 (GRCm39) I115N possibly damaging Het
Atrn G A 2: 130,812,131 (GRCm39) C692Y probably damaging Het
Card10 A T 15: 78,665,303 (GRCm39) S717T possibly damaging Het
Cep78 T C 19: 15,947,941 (GRCm39) S408G probably benign Het
Col24a1 G T 3: 145,137,621 (GRCm39) G895* probably null Het
Cs A T 10: 128,186,310 (GRCm39) K34N possibly damaging Het
Dchs1 T C 7: 105,408,435 (GRCm39) E1799G possibly damaging Het
Dlg5 A T 14: 24,187,192 (GRCm39) probably null Het
Dpy19l4 A T 4: 11,265,859 (GRCm39) Y696* probably null Het
Dync1h1 A T 12: 110,595,168 (GRCm39) N1360I probably benign Het
Fgd2 G T 17: 29,593,019 (GRCm39) R423L probably damaging Het
Fmo4 T C 1: 162,621,741 (GRCm39) D490G possibly damaging Het
Gm5113 A T 7: 29,877,648 (GRCm39) probably benign Het
Grid1 T A 14: 35,291,654 (GRCm39) W854R probably damaging Het
H2-M1 T C 17: 36,981,129 (GRCm39) probably null Het
Hivep1 T A 13: 42,309,842 (GRCm39) M694K probably benign Het
Hsd17b6 T C 10: 127,833,645 (GRCm39) T79A possibly damaging Het
Hspa4 A C 11: 53,153,134 (GRCm39) V761G probably benign Het
Ifi203 T C 1: 173,754,523 (GRCm39) Y736C probably damaging Het
Mettl9 T A 7: 120,675,524 (GRCm39) L308Q probably damaging Het
Miox A G 15: 89,220,785 (GRCm39) D230G probably damaging Het
Ncapd3 T A 9: 26,959,522 (GRCm39) C319* probably null Het
Ncs1 C A 2: 31,177,296 (GRCm39) probably null Het
Nell1 T A 7: 49,929,270 (GRCm39) H392Q possibly damaging Het
Nlrp1b C A 11: 71,108,537 (GRCm39) E321D possibly damaging Het
Nlrp9b A T 7: 19,779,725 (GRCm39) H796L probably benign Het
Nudt16l1 C A 16: 4,757,245 (GRCm39) Q53K possibly damaging Het
Nyap1 A G 5: 137,733,231 (GRCm39) S601P probably damaging Het
Odf2l C T 3: 144,859,244 (GRCm39) Q634* probably null Het
Or10al2 A T 17: 37,982,999 (GRCm39) E28D probably benign Het
Or12e14 A G 2: 87,677,037 (GRCm39) I141V probably benign Het
Or1e22 A G 11: 73,377,224 (GRCm39) V142A probably benign Het
Or5ac23 C T 16: 59,149,606 (GRCm39) D89N possibly damaging Het
Or5b120 T A 19: 13,480,571 (GRCm39) V288E probably damaging Het
Or5m10 T A 2: 85,718,074 (GRCm39) L310H probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Pramel21 T A 4: 143,341,615 (GRCm39) Y15N possibly damaging Het
Prl3c1 A G 13: 27,383,393 (GRCm39) I40V probably benign Het
R3hdm4 C T 10: 79,747,779 (GRCm39) A229T probably damaging Het
Rab3gap2 T C 1: 184,995,013 (GRCm39) S851P possibly damaging Het
Ralgapb A T 2: 158,307,859 (GRCm39) I1056F probably damaging Het
Sec16b T C 1: 157,356,899 (GRCm39) Y36H probably benign Het
Setd3 A T 12: 108,073,924 (GRCm39) V451D probably benign Het
Slc35e1 T C 8: 73,238,506 (GRCm39) K334R probably damaging Het
Synj1 A T 16: 90,788,315 (GRCm39) N184K possibly damaging Het
Syt1 T C 10: 108,478,109 (GRCm39) D105G probably benign Het
Taar7e T A 10: 23,913,902 (GRCm39) C131S possibly damaging Het
Tead4 A G 6: 128,220,331 (GRCm39) probably null Het
Tescl C A 7: 24,033,076 (GRCm39) R83L probably damaging Het
Ufd1 G T 16: 18,633,616 (GRCm39) V14F probably benign Het
Ugt1a10 T A 1: 87,983,477 (GRCm39) Y92N probably benign Het
Vmn2r52 C A 7: 9,896,877 (GRCm39) V532L probably benign Het
Vmn2r67 G A 7: 84,801,036 (GRCm39) T300I possibly damaging Het
Wt1 T G 2: 104,997,205 (GRCm39) S381A probably damaging Het
Zbtb44 C T 9: 30,965,504 (GRCm39) Q305* probably null Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGAGAGATGCAGATCTTG -3'
(R):5'- TCAGAGATGGCTCGTTTCAG -3'

Sequencing Primer
(F):5'- GGGGATGACATTTCCTGCTC -3'
(R):5'- CTCGTTTCAGGAGAAAGCGCAC -3'
Posted On 2019-12-20