Incidental Mutation 'R7913:Fmo4'
ID610641
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7913 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162794172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 490 (D490G)
Ref Sequence ENSEMBL: ENSMUSP00000028014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028014
AA Change: D490G

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: D490G

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111525
AA Change: D490G

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: D490G

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Meta Mutation Damage Score 0.5721 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Gm5113 A T 7: 30,178,223 probably benign Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATGAGTTCTGGGGCATG -3'
(R):5'- TTCATTACCTACATGGACGAGC -3'

Sequencing Primer
(F):5'- TGGGGCATGTACCACAGTAATC -3'
(R):5'- TACATGGACGAGCTCACTCAGTG -3'
Posted On2019-12-20