Incidental Mutation 'R7913:Olfr1150-ps1'
ID610645
Institutional Source Beutler Lab
Gene Symbol Olfr1150-ps1
Ensembl Gene ENSMUSG00000070853
Gene Nameolfactory receptor 1150, pseudogene 1
SynonymsMOR264-11, GA_x6K02T2Q125-49347783-49348734
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7913 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87843993-87849541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87846693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 141 (I141V)
Ref Sequence ENSEMBL: ENSMUSP00000150363 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000121186
AA Change: I141V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 GGTTCTGTGGTCAC GGTTCTGTGGTCACCCGTTCTGTGGTCAC 3: 95,888,142 probably benign Het
BC028528 CTGG CTGGATCTGTGGTCAGTGG 3: 95,888,155 probably benign Het
BC028528 TGTG TGTGTTCACTGGTTCAGTG 3: 95,888,162 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
BC028528 T TAACTGGTTCTGTGGC 3: 95,888,182 probably benign Het
BC028528 ACTGGTT ACTGGTTCTGTGGTCTCTGGTT 3: 95,888,184 probably benign Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Olfr1150-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5985:Olfr1150-ps1 UTSW 2 87357605 missense probably benign 0.01
R6494:Olfr1150-ps1 UTSW 2 87357632 nonsense probably null
R7419:Olfr1150-ps1 UTSW 2 87847062 missense probably benign 0.41
R7450:Olfr1150-ps1 UTSW 2 87846459 missense probably damaging 0.98
R7994:Olfr1150-ps1 UTSW 2 87846693 missense probably benign
RF012:Olfr1150-ps1 UTSW 2 87846759 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTCCCAAGGATTCTGTTCAAC -3'
(R):5'- TATAAAAGGGAATGCAGCCACC -3'

Sequencing Primer
(F):5'- CCCAAGGATTCTGTTCAACATTGGG -3'
(R):5'- AATTCATGCACTGAAGTGTCCC -3'
Posted On2019-12-20