Incidental Mutation 'R7913:Nell1'
ID610667
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene NameNEL-like 1
SynonymsB230343H07Rik, l7R6
MMRRC Submission
Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7913 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location49974864-50866608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50279522 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 392 (H392Q)
Ref Sequence ENSEMBL: ENSMUSP00000080550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081872
AA Change: H392Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: H392Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107603
AA Change: H392Q

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: H392Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151721
AA Change: I255K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409
AA Change: I255K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Gm5113 A T 7: 30,178,223 probably benign Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 50120673 missense probably damaging 0.96
IGL01434:Nell1 APN 7 50701208 missense probably benign 0.01
IGL01796:Nell1 APN 7 50176216 splice site probably benign
IGL02048:Nell1 APN 7 50219607 missense probably damaging 0.96
IGL02239:Nell1 APN 7 50249650 missense probably benign 0.08
IGL02860:Nell1 APN 7 50848485 missense probably damaging 0.99
IGL02958:Nell1 APN 7 50220337 critical splice donor site probably null
IGL03143:Nell1 APN 7 50279533 nonsense probably null
IGL03334:Nell1 APN 7 50062611 splice site probably null
D6062:Nell1 UTSW 7 50258191 missense probably benign 0.21
P0018:Nell1 UTSW 7 50120691 missense probably damaging 1.00
R0004:Nell1 UTSW 7 50560759 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0468:Nell1 UTSW 7 50228846 missense probably damaging 0.97
R0483:Nell1 UTSW 7 50230180 missense probably benign 0.07
R0732:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R0945:Nell1 UTSW 7 50219585 missense probably benign 0.07
R1022:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1024:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1075:Nell1 UTSW 7 50853840 missense probably damaging 0.98
R1291:Nell1 UTSW 7 50230250 missense probably benign 0.00
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50848558 missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50701195 missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50560830 missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2263:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R2869:Nell1 UTSW 7 50249657 intron probably benign
R2870:Nell1 UTSW 7 50249657 intron probably benign
R2871:Nell1 UTSW 7 50249657 intron probably benign
R3498:Nell1 UTSW 7 50258179 missense possibly damaging 0.55
R4044:Nell1 UTSW 7 50219619 missense probably damaging 1.00
R4623:Nell1 UTSW 7 50120562 missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4733:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4941:Nell1 UTSW 7 50062638 missense probably benign 0.10
R4942:Nell1 UTSW 7 50120649 missense possibly damaging 0.84
R5233:Nell1 UTSW 7 50176314 missense probably damaging 0.99
R5590:Nell1 UTSW 7 50279611 missense probably damaging 1.00
R5673:Nell1 UTSW 7 50228846 missense probably damaging 0.99
R5741:Nell1 UTSW 7 50560890 splice site probably null
R6345:Nell1 UTSW 7 49975423 missense possibly damaging 0.91
R6916:Nell1 UTSW 7 50701179 missense probably benign 0.00
R7051:Nell1 UTSW 7 50448844 missense unknown
R7302:Nell1 UTSW 7 50856269 missense probably benign
R7339:Nell1 UTSW 7 50279549 missense probably benign 0.01
R7831:Nell1 UTSW 7 49982800 missense possibly damaging 0.85
R8094:Nell1 UTSW 7 50120587 missense probably benign 0.02
R8191:Nell1 UTSW 7 50448874 missense unknown
R8207:Nell1 UTSW 7 50220012 splice site probably null
R8292:Nell1 UTSW 7 50258247 missense probably damaging 1.00
R8340:Nell1 UTSW 7 50220273 missense probably damaging 0.98
Z1176:Nell1 UTSW 7 50560882 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTCTCATACACAGGACAGTC -3'
(R):5'- TGCCCTTGCATAGCCAAATC -3'

Sequencing Primer
(F):5'- AGGACAGTCCAGAGTTTCTCC -3'
(R):5'- GCCAAATCCATATCTGTAGTAACTGG -3'
Posted On2019-12-20