Incidental Mutation 'R7913:Grid1'
ID610688
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7913 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35569697 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 854 (W854R)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: W854R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: W854R

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Gm5113 A T 7: 30,178,223 probably benign Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGGCTCACCTGTGTTG -3'
(R):5'- TATACAATGCTGCTGTGTCCAG -3'

Sequencing Primer
(F):5'- ATCTTGCAGGATCCTGGAGC -3'
(R):5'- CAATGCTGCTGTGTCCAGACAAG -3'
Posted On2019-12-20