Incidental Mutation 'R7913:Fgd2'
ID 610695
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R7913 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29374045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 423 (R423L)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably damaging
Transcript: ENSMUST00000024810
AA Change: R423L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: R423L

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123989
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Gm5113 A T 7: 30,178,223 probably benign Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29378347 missense probably benign 0.45
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29376921 missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29364960 missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9088:Fgd2 UTSW 17 29364939 missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29364981 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGACTTGGTTTGGCATGTATAAC -3'
(R):5'- AGACACATACCGCTAACTAGGG -3'

Sequencing Primer
(F):5'- CATGTATAACCTGGAGCTGATAGC -3'
(R):5'- TACCGCTAACTAGGGAACTCTGG -3'
Posted On 2019-12-20