Incidental Mutation 'R7913:Cep78'
ID610698
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R7913 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15970577 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 408 (S408G)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably benign
Transcript: ENSMUST00000047704
AA Change: S408G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: S408G

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 GGTTCTGTGGTCAC GGTTCTGTGGTCACCCGTTCTGTGGTCAC 3: 95,888,142 probably benign Het
BC028528 CTGG CTGGATCTGTGGTCAGTGG 3: 95,888,155 probably benign Het
BC028528 TGTG TGTGTTCACTGGTTCAGTG 3: 95,888,162 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
BC028528 T TAACTGGTTCTGTGGC 3: 95,888,182 probably benign Het
BC028528 ACTGGTT ACTGGTTCTGTGGTCTCTGGTT 3: 95,888,184 probably benign Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R2958:Cep78 UTSW 19 15978909 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5783:Cep78 UTSW 19 15956359 missense probably benign 0.02
R5791:Cep78 UTSW 19 15961072 missense probably benign 0.19
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R5924:Cep78 UTSW 19 15961066 missense probably damaging 1.00
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 intron probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7994:Cep78 UTSW 19 15970577 missense probably benign
R8059:Cep78 UTSW 19 15981512 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGATGAAACGACTGGCTTCC -3'
(R):5'- AAAGTGTGGATCCCCTGGAG -3'

Sequencing Primer
(F):5'- CATGGCACTGGGATTCCTATCAG -3'
(R):5'- CTGGAGCCGAATGTGTACAGTC -3'
Posted On2019-12-20