Mutagenetix > Incidental Mutation

Incidental Mutation 'R0684:Olfr713'

61073

Institutional Source

Beutler Lab

Gene Symbol

Olfr713

Ensembl Gene

ENSMUSG00000073898

Gene Name

olfactory receptor 713

Synonyms

GA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3

MMRRC Submission

038869-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R0684 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

107031174-107040994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107036682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 176 (N176Y)

Ref Sequence

ENSEMBL: ENSMUSP00000150042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098138] [ENSMUST00000098139] [ENSMUST00000213623]

AlphaFold

Q920G5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098138
AA Change: N176Y

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095741
Gene: ENSMUSG00000073897
AA Change: N176Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	309	2.6e-58	PFAM
Pfam:7tm_1	42	291	2.2e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098139
AA Change: N183Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: N183Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	39	316	4.4e-57	PFAM
Pfam:7tm_1	49	298	2e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213623
AA Change: N176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7038

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.1%
20x: 88.8%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630095E13Rik	C	T	9: 36,637,880	G28E	probably benign	Het
Adam4	A	T	12: 81,419,654	L731H	probably damaging	Het
Adora2b	C	T	11: 62,249,169	A23V	probably benign	Het
Ankrd17	T	C	5: 90,263,998	I1336V	probably damaging	Het
Asxl1	G	A	2: 153,397,522	R410H	probably damaging	Het
Atp8a2	T	C	14: 60,023,144	E419G	probably benign	Het
Atxn1l	A	T	8: 109,732,384	N415K	probably damaging	Het
Bcl2l12	T	A	7: 44,996,601	T65S	probably benign	Het
Bdh2	A	G	3: 135,291,013	I90V	probably benign	Het
Bsph1	T	A	7: 13,473,063	N121K	probably damaging	Het
Cd96	T	C	16: 46,117,790	Y104C	possibly damaging	Het
Chdh	T	C	14: 30,031,613	W160R	probably damaging	Het
Clock	A	G	5: 76,245,518	F193L	probably damaging	Het
Copz1	A	G	15: 103,296,531		probably null	Het
Cyp2c38	T	C	19: 39,391,056	T450A	probably damaging	Het
Cyp2d34	A	T	15: 82,617,550	I253K	probably benign	Het
Dhrs13	G	T	11: 78,036,963	A212S	probably damaging	Het
Ecsit	T	C	9: 22,076,500	N81S	probably benign	Het
Efl1	A	G	7: 82,651,886	T33A	probably damaging	Het
Emid1	T	C	11: 5,143,866	R92G	probably damaging	Het
Ermp1	A	G	19: 29,632,541		probably benign	Het
Fn1	A	T	1: 71,595,809		probably null	Het
Hps5	A	G	7: 46,783,469		probably null	Het
Hsd17b3	T	C	13: 64,089,068	M21V	probably benign	Het
Kat6b	T	C	14: 21,668,781	V1176A	probably benign	Het
Midn	A	G	10: 80,156,502	K463E	probably damaging	Het
Mier1	A	G	4: 103,139,434	E103G	probably damaging	Het
Muc15	A	G	2: 110,733,815	N232S	possibly damaging	Het
Ncoa2	T	A	1: 13,224,651	E15V	probably damaging	Het
Olfr136	A	G	17: 38,335,844	K229R	probably benign	Het
Olfr667	T	A	7: 104,916,634	T221S	probably benign	Het
Pigf	A	T	17: 87,020,495	F115I	probably benign	Het
Prpsap1	A	T	11: 116,471,491	V355E	probably damaging	Het
Ptprk	G	T	10: 28,483,298		probably benign	Het
Rae1	G	A	2: 173,005,164	R67H	probably damaging	Het
Sema3a	G	A	5: 13,556,527		probably null	Het
Slc22a22	T	C	15: 57,263,362	T104A	probably benign	Het
Slc38a2	A	T	15: 96,695,287	L137*	probably null	Het
Smgc	A	G	15: 91,841,467		probably benign	Het
Syce3	A	G	15: 89,390,445		probably benign	Het
Syt9	T	A	7: 107,425,136	W79R	probably damaging	Het
Tgoln1	A	C	6: 72,615,991	S169A	probably benign	Het
Thnsl1	A	G	2: 21,211,666	D77G	probably benign	Het
Tsr1	T	A	11: 74,907,941	V712E	probably damaging	Het
Wdr12	C	T	1: 60,089,366		probably benign	Het
Xdh	T	A	17: 73,943,891	N22I	probably damaging	Het
Zfp3	T	A	11: 70,771,569	L118Q	probably benign	Het
Zfp592	A	G	7: 81,037,875	N883D	probably benign	Het
Zfp609	T	A	9: 65,731,201	M250L	probably benign	Het
Zfp94	A	T	7: 24,303,070	S316T	probably damaging	Het
Zfp955b	A	G	17: 33,302,973	N472S	probably benign	Het

Other mutations in Olfr713

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Olfr713	APN	7	107036847	missense	probably damaging	0.99
IGL01630:Olfr713	APN	7	107037111	utr 3 prime	probably benign
IGL02539:Olfr713	APN	7	107036434	missense	probably damaging	1.00
IGL02727:Olfr713	APN	7	107036695	missense	probably damaging	1.00
IGL03336:Olfr713	APN	7	107036335	missense	probably damaging	1.00
R0501:Olfr713	UTSW	7	107036232	missense	probably benign
R0909:Olfr713	UTSW	7	107036194	missense	probably benign	0.19
R1481:Olfr713	UTSW	7	107036149	missense	probably benign	0.05
R1958:Olfr713	UTSW	7	107036271	missense	possibly damaging	0.77
R1965:Olfr713	UTSW	7	107036358	missense	probably damaging	1.00
R2119:Olfr713	UTSW	7	107036731	missense	probably damaging	1.00
R2149:Olfr713	UTSW	7	107036338	missense	possibly damaging	0.68
R3012:Olfr713	UTSW	7	107036362	missense	possibly damaging	0.79
R3428:Olfr713	UTSW	7	107036716	missense	probably benign
R4425:Olfr713	UTSW	7	107036491	missense	probably damaging	1.00
R4795:Olfr713	UTSW	7	107036914	missense	probably benign	0.00
R4796:Olfr713	UTSW	7	107036914	missense	probably benign	0.00
R4908:Olfr713	UTSW	7	107036157	start codon destroyed	probably benign	0.02
R4945:Olfr713	UTSW	7	107036319	missense	probably benign	0.00
R5122:Olfr713	UTSW	7	107036848	nonsense	probably null
R5721:Olfr713	UTSW	7	107036358	missense	probably damaging	1.00
R5979:Olfr713	UTSW	7	107036336	missense	probably damaging	1.00
R6739:Olfr713	UTSW	7	107036811	missense	probably damaging	1.00
R6981:Olfr713	UTSW	7	107036749	missense	possibly damaging	0.77
R7197:Olfr713	UTSW	7	107036157	missense	probably benign	0.03
R7228:Olfr713	UTSW	7	107037100	missense	probably benign
R7444:Olfr713	UTSW	7	107036347	missense	probably damaging	1.00
R8830:Olfr713	UTSW	7	107036682	missense	probably benign	0.28
R9109:Olfr713	UTSW	7	107036433	missense	probably damaging	1.00
R9298:Olfr713	UTSW	7	107036433	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCTGCAAAGCCCCATGTATTTC -3'
(R):5'- TCTTGAGGATGGAAGCCGCAATG -3'

Sequencing Primer
(F):5'- GCCCAAAATGTTGGGGACTC -3'
(R):5'- CCGCAATGAGAGTGTATGAAC -3'

Posted On

2013-07-30