Incidental Mutation 'R0684:Kat6b'
ID61084
Institutional Source Beutler Lab
Gene Symbol Kat6b
Ensembl Gene ENSMUSG00000021767
Gene NameK(lysine) acetyltransferase 6B
SynonymsMyst4, monocytic leukemia, querkopf, B130044K16Rik, Morf, qkf
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R0684 (G1)
Quality Score143
Status Validated
Chromosome14
Chromosomal Location21481434-21672478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21668781 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1176 (V1176A)
Ref Sequence ENSEMBL: ENSMUSP00000138421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069648] [ENSMUST00000112458] [ENSMUST00000182405] [ENSMUST00000182855] [ENSMUST00000182964]
Predicted Effect probably benign
Transcript: ENSMUST00000069648
AA Change: V1176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066693
Gene: ENSMUSG00000021767
AA Change: V1176A

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 594 772 4.5e-85 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112458
SMART Domains Protein: ENSMUSP00000108077
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 159 3.4e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182405
AA Change: V1067A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138377
Gene: ENSMUSG00000021767
AA Change: V1067A

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182855
AA Change: V1067A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138511
Gene: ENSMUSG00000021767
AA Change: V1067A

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182964
AA Change: V1176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138421
Gene: ENSMUSG00000021767
AA Change: V1176A

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 591 778 1.4e-89 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Reduced expression of this gene results in developmental defects of the skeleton and brain, particularly the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Kat6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kat6b APN 14 21668559 missense probably benign 0.00
IGL01128:Kat6b APN 14 21660860 missense probably benign
IGL02272:Kat6b APN 14 21626778 missense probably damaging 0.99
IGL02349:Kat6b APN 14 21637593 missense probably damaging 0.99
IGL02402:Kat6b APN 14 21631347 missense probably damaging 1.00
IGL02474:Kat6b APN 14 21669039 missense possibly damaging 0.95
IGL02516:Kat6b APN 14 21609868 splice site probably benign
IGL02666:Kat6b APN 14 21628870 missense probably damaging 1.00
IGL02971:Kat6b APN 14 21669758 missense probably damaging 1.00
IGL03075:Kat6b APN 14 21661570 nonsense probably null
IGL03274:Kat6b APN 14 21609763 missense possibly damaging 0.95
IGL03308:Kat6b APN 14 21624834 missense probably damaging 0.99
R0118:Kat6b UTSW 14 21669974 missense probably damaging 0.99
R0383:Kat6b UTSW 14 21669081 missense probably benign 0.02
R0441:Kat6b UTSW 14 21670233 missense probably damaging 1.00
R0457:Kat6b UTSW 14 21670530 missense probably damaging 0.96
R0558:Kat6b UTSW 14 21669421 missense probably benign 0.03
R0662:Kat6b UTSW 14 21662349 small deletion probably benign
R0755:Kat6b UTSW 14 21637593 missense probably damaging 0.99
R1216:Kat6b UTSW 14 21622040 nonsense probably null
R1479:Kat6b UTSW 14 21618956 missense probably benign 0.19
R1873:Kat6b UTSW 14 21516989 missense probably damaging 1.00
R1957:Kat6b UTSW 14 21628879 missense probably damaging 1.00
R2151:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2152:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2153:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2154:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2399:Kat6b UTSW 14 21662349 small deletion probably benign
R3740:Kat6b UTSW 14 21670044 missense probably damaging 0.99
R3771:Kat6b UTSW 14 21517098 missense probably damaging 1.00
R4178:Kat6b UTSW 14 21618904 nonsense probably null
R4261:Kat6b UTSW 14 21669669 missense probably damaging 1.00
R4551:Kat6b UTSW 14 21661448 missense probably damaging 1.00
R4724:Kat6b UTSW 14 21660962 missense probably benign
R5055:Kat6b UTSW 14 21516994 missense probably damaging 0.99
R5098:Kat6b UTSW 14 21619015 splice site probably benign
R5121:Kat6b UTSW 14 21619258 missense probably damaging 0.98
R5158:Kat6b UTSW 14 21669986 missense possibly damaging 0.93
R5488:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5489:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5653:Kat6b UTSW 14 21669372 missense probably benign 0.10
R5742:Kat6b UTSW 14 21668435 missense probably damaging 0.99
R5868:Kat6b UTSW 14 21634479 missense probably damaging 1.00
R5969:Kat6b UTSW 14 21670792 missense probably damaging 0.97
R6110:Kat6b UTSW 14 21670487 missense probably damaging 1.00
R6427:Kat6b UTSW 14 21517412 missense probably benign 0.24
R6457:Kat6b UTSW 14 21670680 missense probably damaging 1.00
R6639:Kat6b UTSW 14 21517494 missense possibly damaging 0.57
R6891:Kat6b UTSW 14 21669036 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTCAAGCTGAACCTGTACACCC -3'
(R):5'- AGGACATTGTGAGATCAACACCGC -3'

Sequencing Primer
(F):5'- AGAGACCGTGGATGCCTTG -3'
(R):5'- GCAGTTCATCAAGACTTCAGG -3'
Posted On2013-07-30