Incidental Mutation 'R7916:Scn7a'
ID610889
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66676150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1465 (D1465G)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: D1465G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: D1465G

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAACCTGTTCCACAC -3'
(R):5'- TCTACGCCATCTTTGGAATGTAC -3'

Sequencing Primer
(F):5'- TGTTCCACACCCGGAAGAATCTC -3'
(R):5'- CTTTGCCTATGTAAAGAAAGAAGCCG -3'
Posted On2019-12-27