Incidental Mutation 'R7916:Qrfpr'
ID610899
Institutional Source Beutler Lab
Gene Symbol Qrfpr
Ensembl Gene ENSMUSG00000058400
Gene Namepyroglutamylated RFamide peptide receptor
SynonymsGpr103, AQ27
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location36179424-36222313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36189602 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 117 (I117V)
Ref Sequence ENSEMBL: ENSMUSP00000088768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091227] [ENSMUST00000197447]
Predicted Effect probably benign
Transcript: ENSMUST00000091227
AA Change: I117V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088768
Gene: ENSMUSG00000058400
AA Change: I117V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 347 3.6e-8 PFAM
Pfam:7tm_1 62 332 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197447
AA Change: I117V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143773
Gene: ENSMUSG00000058400
AA Change: I117V

DomainStartEndE-ValueType
low complexity region 40 61 N/A INTRINSIC
Pfam:7tm_1 62 229 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation diisplay kyphosis with abnormal vertebrae morphology and development including osteopenia of the vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Qrfpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Qrfpr APN 3 36181051 splice site probably null
IGL02274:Qrfpr APN 3 36222136 missense probably damaging 0.98
R0382:Qrfpr UTSW 3 36180969 missense possibly damaging 0.73
R0398:Qrfpr UTSW 3 36181052 splice site probably benign
R0631:Qrfpr UTSW 3 36221989 missense probably damaging 1.00
R0690:Qrfpr UTSW 3 36189559 missense probably damaging 1.00
R1222:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1413:Qrfpr UTSW 3 36182660 missense possibly damaging 0.92
R1418:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1500:Qrfpr UTSW 3 36182580 missense probably damaging 1.00
R2037:Qrfpr UTSW 3 36182657 missense probably damaging 0.99
R3924:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3925:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3966:Qrfpr UTSW 3 36181000 missense possibly damaging 0.73
R4298:Qrfpr UTSW 3 36189554 missense probably damaging 1.00
R4751:Qrfpr UTSW 3 36182622 missense possibly damaging 0.67
R4760:Qrfpr UTSW 3 36221924 missense probably benign 0.34
R4989:Qrfpr UTSW 3 36222136 missense probably damaging 0.98
R5548:Qrfpr UTSW 3 36221926 missense possibly damaging 0.84
R5607:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R5608:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R6027:Qrfpr UTSW 3 36222038 missense probably benign 0.44
R6115:Qrfpr UTSW 3 36182593 missense possibly damaging 0.51
R6546:Qrfpr UTSW 3 36180265 missense probably damaging 1.00
R6714:Qrfpr UTSW 3 36180256 missense possibly damaging 0.81
R7080:Qrfpr UTSW 3 36180049 missense probably benign 0.04
R7833:Qrfpr UTSW 3 36189602 missense probably benign
Z1176:Qrfpr UTSW 3 36182610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCCAAATTGTCAGTACCAG -3'
(R):5'- TGTTCAATGCCCCTGAGAGC -3'

Sequencing Primer
(F):5'- GTACCAGATATTTTTGTCGAGTGAC -3'
(R):5'- CCCCTGAGAGCATAAAACTAGTTGG -3'
Posted On2019-12-27