Incidental Mutation 'R0684:Zfp955b'
ID61091
Institutional Source Beutler Lab
Gene Symbol Zfp955b
Ensembl Gene ENSMUSG00000096910
Gene Namezinc finger protein 955B
SynonymsA430003O12Rik, C430039G02Rik, Gm4455
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0684 (G1)
Quality Score152
Status Validated
Chromosome17
Chromosomal Location33289649-33303196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33302973 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 472 (N472S)
Ref Sequence ENSEMBL: ENSMUSP00000097011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099414]
Predicted Effect probably benign
Transcript: ENSMUST00000099414
AA Change: N472S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097011
Gene: ENSMUSG00000096910
AA Change: N472S

DomainStartEndE-ValueType
KRAB 10 70 3.04e-14 SMART
ZnF_C2H2 230 252 7.68e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.75e0 SMART
ZnF_C2H2 318 340 5.81e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 7.78e-3 SMART
ZnF_C2H2 430 452 3.16e-3 SMART
ZnF_C2H2 458 480 1.1e-2 SMART
ZnF_C2H2 486 508 2.09e-3 SMART
ZnF_C2H2 514 536 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182230
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Other mutations in Zfp955b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zfp955b APN 17 33302873 missense probably damaging 1.00
IGL02073:Zfp955b APN 17 33300590 missense possibly damaging 0.69
IGL02126:Zfp955b APN 17 33302264 nonsense probably null
IGL02237:Zfp955b APN 17 33301919 missense probably damaging 1.00
IGL02587:Zfp955b APN 17 33300650 missense probably damaging 1.00
IGL02971:Zfp955b APN 17 33300966 missense probably benign 0.11
IGL03034:Zfp955b APN 17 33302168 missense probably benign 0.22
IGL03493:Zfp955b APN 17 33302545 missense probably benign 0.35
R0269:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0373:Zfp955b UTSW 17 33302522 missense probably benign
R0617:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R1778:Zfp955b UTSW 17 33302814 missense probably benign 0.07
R1874:Zfp955b UTSW 17 33305453 missense probably benign 0.10
R3893:Zfp955b UTSW 17 33302994 missense probably benign 0.01
R3938:Zfp955b UTSW 17 33305416 missense probably damaging 1.00
R4082:Zfp955b UTSW 17 33302155 missense probably benign 0.08
R4672:Zfp955b UTSW 17 33305259 unclassified probably benign
R4956:Zfp955b UTSW 17 33305235 unclassified probably benign
R4998:Zfp955b UTSW 17 33305151 unclassified probably benign
R5276:Zfp955b UTSW 17 33303057 missense probably damaging 1.00
R5341:Zfp955b UTSW 17 33305121 unclassified probably benign
R5558:Zfp955b UTSW 17 33302187 missense possibly damaging 0.88
R6086:Zfp955b UTSW 17 33302504 missense probably benign
R6170:Zfp955b UTSW 17 33302110 missense probably benign 0.00
R6306:Zfp955b UTSW 17 33303186 missense probably benign 0.07
R6519:Zfp955b UTSW 17 33302077 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCAGTGAGGGCAACTGTTCCAAC -3'
(R):5'- CCCAATGGGTTTCTTTCCATGACCG -3'

Sequencing Primer
(F):5'- TGCAGGAAAAACCTACGTTTG -3'
(R):5'- ttgaagggatttggaaaaggtg -3'
Posted On2013-07-30