Incidental Mutation 'R7916:Mybbp1a'
ID610928
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene NameMYB binding protein (P160) 1a
Synonymsp160MBP, p67MBP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72441355-72451768 bp(+) (GRCm38)
Type of Mutationintron (48 bp from exon)
DNA Base Change (assembly) A to G at 72442901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633] [ENSMUST00000076443] [ENSMUST00000100903]
Predicted Effect probably null
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076443
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100903
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
fratelli UTSW 11 72445712 missense probably benign 0.02
nonnae UTSW 11 72446012 missense probably damaging 1.00
sorelli UTSW 11 72447759 missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72450107 unclassified probably null
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72445214 missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72446172 missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72444925 missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72447642 splice site probably null
R7227:Mybbp1a UTSW 11 72447759 missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72443512 missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72451275 missense probably benign 0.01
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGCTCTCTGTGGATACCAG -3'
(R):5'- AGGCATTGACAAGCACTGTTC -3'

Sequencing Primer
(F):5'- CTCTCTGTGGATACCAGGACAAAG -3'
(R):5'- TTGACAAGCACTGTTCCAGAC -3'
Posted On2019-12-27