Incidental Mutation 'R7916:F2rl2'
ID610941
Institutional Source Beutler Lab
Gene Symbol F2rl2
Ensembl Gene ENSMUSG00000021675
Gene Namecoagulation factor II (thrombin) receptor-like 2
SynonymsPAR3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7916 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95696853-95702739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95700918 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 157 (N157S)
Ref Sequence ENSEMBL: ENSMUSP00000022182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022182] [ENSMUST00000068603]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022182
AA Change: N157S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022182
Gene: ENSMUSG00000021675
AA Change: N157S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:7tm_1 110 295 1.7e-32 PFAM
Pfam:7tm_1 297 357 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding times, delayed and reduced thrombin responses in platelets, and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in F2rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:F2rl2 APN 13 95701328 missense probably benign 0.00
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0969:F2rl2 UTSW 13 95700953 missense probably damaging 1.00
R1183:F2rl2 UTSW 13 95701113 missense probably damaging 0.96
R1482:F2rl2 UTSW 13 95701539 missense probably benign 0.02
R1753:F2rl2 UTSW 13 95701461 missense probably benign 0.16
R2428:F2rl2 UTSW 13 95697077 missense possibly damaging 0.75
R3151:F2rl2 UTSW 13 95701130 missense probably benign 0.00
R4678:F2rl2 UTSW 13 95700632 missense probably benign 0.10
R5153:F2rl2 UTSW 13 95697112 missense probably benign 0.00
R5229:F2rl2 UTSW 13 95700687 missense possibly damaging 0.93
R5635:F2rl2 UTSW 13 95700782 missense possibly damaging 0.88
R6041:F2rl2 UTSW 13 95701109 missense probably benign 0.01
R6146:F2rl2 UTSW 13 95700641 missense probably benign 0.08
R6974:F2rl2 UTSW 13 95700530 missense probably damaging 0.97
R6993:F2rl2 UTSW 13 95701134 missense probably damaging 1.00
R7833:F2rl2 UTSW 13 95700918 missense probably damaging 0.96
R7869:F2rl2 UTSW 13 95701011 missense probably damaging 0.99
R7952:F2rl2 UTSW 13 95701011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTCCACGTGAATAATGCTACC -3'
(R):5'- CATGAGCATGGAGAAGCTGC -3'

Sequencing Primer
(F):5'- GCTACCATAGGATACCTGAGAAGTTC -3'
(R):5'- AGCATGGAGAAGCTGCGTTTG -3'
Posted On2019-12-27