Incidental Mutation 'R7917:Abcb11'
ID610969
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7917 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69284724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 626 (I626N)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7836:Abcb11 UTSW 2 69323873 small deletion probably benign
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7896:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGGGCTTTGTAGGAATAATAAG -3'
(R):5'- CTAGGGTCCAAAGCTGACTTCC -3'

Sequencing Primer
(F):5'- CATAAGTTGAACCAGCAGCATAAATG -3'
(R):5'- AAAGCTGACTTCCTTGTGGAC -3'
Posted On2019-12-27