Incidental Mutation 'R0685:Scai'
ID 61098
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Name suppressor of cancer cell invasion
Synonyms A930041I02Rik
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.570) question?
Stock # R0685 (G1)
Quality Score 172
Status Validated
Chromosome 2
Chromosomal Location 38956226-39080746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38993749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 297 (M297K)
Ref Sequence ENSEMBL: ENSMUSP00000145133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204500] [ENSMUST00000204404]
AlphaFold Q8C8N2
Predicted Effect possibly damaging
Transcript: ENSMUST00000038874
AA Change: M297K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: M297K

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131225
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203872
Predicted Effect probably damaging
Transcript: ENSMUST00000204093
AA Change: M297K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236
AA Change: M297K

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204500
SMART Domains Protein: ENSMUSP00000144844
Gene: ENSMUSG00000035236

DomainStartEndE-ValueType
Pfam:DUF3550 1 77 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Meta Mutation Damage Score 0.4715 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,469,337 (GRCm39) D17G probably damaging Het
Abi3bp A G 16: 56,353,316 (GRCm39) T82A possibly damaging Het
Adgre4 A C 17: 56,099,035 (GRCm39) E180D probably benign Het
Ankrd28 G A 14: 31,465,407 (GRCm39) probably benign Het
Aoc3 A G 11: 101,227,273 (GRCm39) D382G possibly damaging Het
Apob C A 12: 8,060,742 (GRCm39) R3075S probably benign Het
Aqr A G 2: 113,971,458 (GRCm39) F459S probably damaging Het
Bcr T C 10: 74,967,475 (GRCm39) W570R probably damaging Het
Bloc1s5 C T 13: 38,787,895 (GRCm39) R163K probably benign Het
Bod1 A T 11: 31,619,267 (GRCm39) N101K possibly damaging Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Chl1 G A 6: 103,685,503 (GRCm39) probably null Het
Clstn1 G A 4: 149,731,312 (GRCm39) A885T probably benign Het
Cyp3a25 G T 5: 145,935,356 (GRCm39) P87T probably damaging Het
Dync1h1 T C 12: 110,623,626 (GRCm39) V3633A probably damaging Het
Dynlt5 T C 4: 102,859,735 (GRCm39) Y96H probably damaging Het
Elp4 C A 2: 105,622,622 (GRCm39) C241F possibly damaging Het
Fat4 T A 3: 39,055,327 (GRCm39) F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 (GRCm39) H381Y possibly damaging Het
Gm10577 G T 4: 100,877,515 (GRCm39) probably benign Het
Gm9955 G T 18: 24,842,314 (GRCm39) probably benign Het
Gstm5 T A 3: 107,804,635 (GRCm39) I73N probably damaging Het
Gypa T A 8: 81,223,331 (GRCm39) probably benign Het
Hectd2 T A 19: 36,546,831 (GRCm39) V64D probably damaging Het
Igkv10-95 T A 6: 68,657,543 (GRCm39) Y20N probably benign Het
Il15 T C 8: 83,064,188 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kiz C A 2: 146,697,978 (GRCm39) probably benign Het
Lcmt2 C A 2: 120,969,721 (GRCm39) S234I probably benign Het
Lilra5 A G 7: 4,244,956 (GRCm39) probably benign Het
Lin37 T C 7: 30,255,299 (GRCm39) E187G probably damaging Het
Lrrc37 T C 11: 103,507,714 (GRCm39) probably benign Het
Mcmdc2 T A 1: 9,982,039 (GRCm39) probably null Het
Mctp1 T C 13: 76,973,918 (GRCm39) probably null Het
Mdp1 C A 14: 55,896,726 (GRCm39) G112* probably null Het
Mmp15 T C 8: 96,098,762 (GRCm39) Y530H possibly damaging Het
Mtss2 T C 8: 111,454,029 (GRCm39) probably null Het
Muc5ac T C 7: 141,361,446 (GRCm39) S1586P probably benign Het
Nap1l5 A T 6: 58,883,757 (GRCm39) C66S possibly damaging Het
Ninl G T 2: 150,781,775 (GRCm39) Q1237K possibly damaging Het
Or5p70 A T 7: 107,994,470 (GRCm39) T48S possibly damaging Het
Or9m1b T C 2: 87,836,762 (GRCm39) E111G probably damaging Het
Orc6 T G 8: 86,027,783 (GRCm39) S37R possibly damaging Het
Papss1 A C 3: 131,288,854 (GRCm39) N119H possibly damaging Het
Phf13 A T 4: 152,076,069 (GRCm39) F278I probably damaging Het
Pole2 C A 12: 69,258,187 (GRCm39) A239S probably damaging Het
Ppt2 T C 17: 34,845,546 (GRCm39) D75G probably damaging Het
Psd2 A G 18: 36,136,044 (GRCm39) D443G possibly damaging Het
Psen1 C A 12: 83,761,594 (GRCm39) S132* probably null Het
Psme4 A G 11: 30,828,415 (GRCm39) T1812A probably damaging Het
Rasgrf1 T C 9: 89,797,535 (GRCm39) probably benign Het
Reep3 A G 10: 66,857,518 (GRCm39) probably benign Het
Rexo4 A T 2: 26,848,586 (GRCm39) probably benign Het
Rnf6 A C 5: 146,148,468 (GRCm39) S183R probably damaging Het
Scn9a A T 2: 66,313,843 (GRCm39) S1947R probably benign Het
Sema6c T C 3: 95,080,021 (GRCm39) C772R possibly damaging Het
Skint7 T C 4: 111,837,542 (GRCm39) S107P possibly damaging Het
Slc24a3 A G 2: 145,448,715 (GRCm39) N420D probably benign Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Smg7 G A 1: 152,742,399 (GRCm39) P82L probably damaging Het
Sp3 A C 2: 72,801,342 (GRCm39) F268V probably damaging Het
Srms T C 2: 180,854,426 (GRCm39) D47G probably benign Het
Ss18 A C 18: 14,784,238 (GRCm39) M150R probably damaging Het
Taf5 G A 19: 47,063,293 (GRCm39) R281Q probably benign Het
Tars1 T C 15: 11,385,259 (GRCm39) K644R probably benign Het
Tinag C A 9: 76,859,285 (GRCm39) W441L probably damaging Het
Tmtc1 T C 6: 148,312,738 (GRCm39) S244G probably benign Het
Tpr T C 1: 150,309,476 (GRCm39) V1670A possibly damaging Het
Trpv3 A G 11: 73,187,640 (GRCm39) probably benign Het
Uhrf1 G T 17: 56,617,742 (GRCm39) V155L probably damaging Het
Ush2a G A 1: 188,132,475 (GRCm39) C899Y probably damaging Het
Vmn2r115 G A 17: 23,578,249 (GRCm39) R574H probably benign Het
Vmn2r63 T C 7: 42,577,434 (GRCm39) D368G probably benign Het
Vps13a A G 19: 16,758,105 (GRCm39) V10A probably damaging Het
Wbp11 A G 6: 136,791,636 (GRCm39) probably benign Het
Zcwpw1 A G 5: 137,797,854 (GRCm39) D145G probably benign Het
Zfp607a G A 7: 27,577,901 (GRCm39) V324I probably damaging Het
Zfp618 A G 4: 63,052,011 (GRCm39) I931V probably benign Het
Zfp821 T C 8: 110,451,174 (GRCm39) V389A possibly damaging Het
Zfp976 T A 7: 42,263,141 (GRCm39) H232L probably damaging Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 38,998,406 (GRCm39) missense probably damaging 1.00
IGL01366:Scai APN 2 38,996,973 (GRCm39) missense probably benign 0.36
IGL01739:Scai APN 2 38,984,803 (GRCm39) splice site probably benign
IGL02251:Scai APN 2 38,989,429 (GRCm39) missense probably benign 0.01
IGL02274:Scai APN 2 38,992,329 (GRCm39) unclassified probably benign
R0239:Scai UTSW 2 38,965,054 (GRCm39) missense probably benign 0.00
R0239:Scai UTSW 2 38,965,054 (GRCm39) missense probably benign 0.00
R0904:Scai UTSW 2 38,965,164 (GRCm39) missense possibly damaging 0.90
R1655:Scai UTSW 2 38,970,129 (GRCm39) missense possibly damaging 0.79
R1820:Scai UTSW 2 38,996,990 (GRCm39) missense possibly damaging 0.82
R1913:Scai UTSW 2 38,970,093 (GRCm39) missense probably damaging 1.00
R2068:Scai UTSW 2 39,013,025 (GRCm39) missense probably damaging 1.00
R2183:Scai UTSW 2 38,970,138 (GRCm39) missense probably benign 0.00
R3237:Scai UTSW 2 39,040,326 (GRCm39) splice site probably benign
R3933:Scai UTSW 2 38,965,064 (GRCm39) missense probably benign 0.44
R5460:Scai UTSW 2 38,973,586 (GRCm39) missense probably damaging 1.00
R5460:Scai UTSW 2 38,973,585 (GRCm39) missense probably damaging 1.00
R6089:Scai UTSW 2 38,973,566 (GRCm39) nonsense probably null
R6377:Scai UTSW 2 38,992,340 (GRCm39) missense probably benign 0.02
R6606:Scai UTSW 2 38,965,147 (GRCm39) missense probably benign 0.00
R7034:Scai UTSW 2 39,011,147 (GRCm39) missense probably damaging 1.00
R7037:Scai UTSW 2 39,080,633 (GRCm39) missense probably benign 0.04
R7171:Scai UTSW 2 38,996,948 (GRCm39) missense possibly damaging 0.48
R7451:Scai UTSW 2 39,015,148 (GRCm39) missense probably damaging 1.00
R7737:Scai UTSW 2 39,013,034 (GRCm39) missense probably damaging 0.96
R8856:Scai UTSW 2 38,996,978 (GRCm39) missense probably benign 0.01
R8890:Scai UTSW 2 39,040,400 (GRCm39) intron probably benign
R9040:Scai UTSW 2 38,965,164 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTCTGACTGTGCTTATCAACTGTGTCT -3'
(R):5'- ACTGCATAAATCTTTTGTCACATTTGCCTT -3'

Sequencing Primer
(F):5'- actgtttggctgtctagtgtg -3'
(R):5'- tggagggtggaaagagaagg -3'
Posted On 2013-07-30