Incidental Mutation 'R7917:Pml'
ID611003
Institutional Source Beutler Lab
Gene Symbol Pml
Ensembl Gene ENSMUSG00000036986
Gene Namepromyelocytic leukemia
SynonymsTrim19, 1200009E24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7917 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location58218076-58249786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58234685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 288 (R288L)
Ref Sequence ENSEMBL: ENSMUSP00000082816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085673] [ENSMUST00000114136] [ENSMUST00000124063] [ENSMUST00000135310] [ENSMUST00000148301] [ENSMUST00000153820]
Predicted Effect probably benign
Transcript: ENSMUST00000085673
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082816
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 5e-7 BLAST
Pfam:DUF3583 244 580 4e-166 PFAM
Blast:EXOIII 619 762 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114136
AA Change: R288L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109771
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 434 5.5e-109 PFAM
Pfam:DUF3583 428 535 1.4e-57 PFAM
Blast:EXOIII 573 716 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124063
SMART Domains Protein: ENSMUSP00000118232
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116787
Gene: ENSMUSG00000036986
AA Change: R279L

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
RING 54 88 1.83e-3 SMART
BBOX 121 163 4.99e-5 SMART
Blast:BBOX 181 225 4e-7 BLAST
Pfam:DUF3583 236 422 1.4e-89 PFAM
Pfam:DUF3583 411 526 2.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135310
AA Change: R288L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122854
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 8.8e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148301
SMART Domains Protein: ENSMUSP00000120620
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153820
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118955
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 9.2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have an increased susceptibility to infection and to induction of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Pml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Pml APN 9 58247003 missense probably benign 0.04
IGL03147:Pml UTSW 9 58230043 missense possibly damaging 0.85
R0019:Pml UTSW 9 58220493 missense probably damaging 1.00
R0905:Pml UTSW 9 58249539 critical splice donor site probably null
R1171:Pml UTSW 9 58234538 missense probably damaging 1.00
R2189:Pml UTSW 9 58234874 missense probably benign 0.00
R2330:Pml UTSW 9 58234571 missense probably damaging 1.00
R2909:Pml UTSW 9 58247243 missense possibly damaging 0.75
R4749:Pml UTSW 9 58234652 missense probably damaging 0.99
R5228:Pml UTSW 9 58219997 missense probably damaging 1.00
R5300:Pml UTSW 9 58247019 missense probably damaging 1.00
R5669:Pml UTSW 9 58247063 missense probably benign 0.00
R5876:Pml UTSW 9 58233182 missense possibly damaging 0.71
R6854:Pml UTSW 9 58219906 missense probably damaging 0.99
R6996:Pml UTSW 9 58234886 missense probably damaging 1.00
R7387:Pml UTSW 9 58229894 missense probably benign 0.08
R7448:Pml UTSW 9 58247213 missense probably benign 0.27
R7762:Pml UTSW 9 58220173 missense probably damaging 1.00
R7833:Pml UTSW 9 58234685 missense probably benign 0.15
R7834:Pml UTSW 9 58234685 missense probably benign 0.15
R7903:Pml UTSW 9 58249584 missense probably benign 0.01
R7916:Pml UTSW 9 58234685 missense probably benign 0.15
R7986:Pml UTSW 9 58249584 missense probably benign 0.01
R8040:Pml UTSW 9 58234685 missense probably benign 0.15
R8041:Pml UTSW 9 58234685 missense probably benign 0.15
R8042:Pml UTSW 9 58234685 missense probably benign 0.15
R8046:Pml UTSW 9 58246973 critical splice donor site probably null
Z1088:Pml UTSW 9 58234590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTACAGAGTGCCTTGC -3'
(R):5'- CTCCATTGCGATATTGGTGAGG -3'

Sequencing Primer
(F):5'- CGCAGAAAGCTGTGCATATC -3'
(R):5'- CGATATTGGTGAGGAGATTCAGC -3'
Posted On2019-12-27