Incidental Mutation 'R7917:Rtn1'
ID611012
Institutional Source Beutler Lab
Gene Symbol Rtn1
Ensembl Gene ENSMUSG00000021087
Gene Namereticulon 1
SynonymsRtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7917 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72211752-72409054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72304032 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 468 (I468F)
Ref Sequence ENSEMBL: ENSMUSP00000077594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078505]
Predicted Effect probably damaging
Transcript: ENSMUST00000078505
AA Change: I468F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: I468F

DomainStartEndE-ValueType
low complexity region 135 152 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 438 448 N/A INTRINSIC
low complexity region 473 480 N/A INTRINSIC
low complexity region 574 586 N/A INTRINSIC
Pfam:Reticulon 593 757 2.2e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Rtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Rtn1 APN 12 72408511 missense probably benign 0.18
IGL01335:Rtn1 APN 12 72308350 missense probably benign
IGL01394:Rtn1 APN 12 72308416 missense probably benign 0.00
IGL01551:Rtn1 APN 12 72216935 missense possibly damaging 0.63
IGL01865:Rtn1 APN 12 72219300 missense probably damaging 1.00
IGL02585:Rtn1 APN 12 72308155 critical splice donor site probably null
PIT4802001:Rtn1 UTSW 12 72304326 missense probably benign 0.21
R0104:Rtn1 UTSW 12 72308845 missense probably damaging 0.99
R0866:Rtn1 UTSW 12 72308382 nonsense probably null
R1099:Rtn1 UTSW 12 72304467 intron probably null
R1438:Rtn1 UTSW 12 72304413 missense probably damaging 0.98
R1610:Rtn1 UTSW 12 72219279 missense possibly damaging 0.90
R1694:Rtn1 UTSW 12 72223524 missense probably damaging 1.00
R1869:Rtn1 UTSW 12 72308168 missense probably damaging 1.00
R1888:Rtn1 UTSW 12 72236533 intron probably benign
R1889:Rtn1 UTSW 12 72304410 missense possibly damaging 0.87
R1892:Rtn1 UTSW 12 72212563 missense probably damaging 1.00
R2418:Rtn1 UTSW 12 72304278 missense probably benign
R2760:Rtn1 UTSW 12 72408362 missense probably benign 0.00
R2973:Rtn1 UTSW 12 72223389 missense probably damaging 1.00
R4567:Rtn1 UTSW 12 72212487 utr 3 prime probably benign
R4880:Rtn1 UTSW 12 72217458 missense possibly damaging 0.88
R4945:Rtn1 UTSW 12 72217484 missense probably damaging 1.00
R6183:Rtn1 UTSW 12 72408491 missense probably benign 0.09
R6493:Rtn1 UTSW 12 72308329 missense probably damaging 0.99
R6547:Rtn1 UTSW 12 72308761 missense possibly damaging 0.59
R6602:Rtn1 UTSW 12 72219318 missense probably damaging 0.99
R7474:Rtn1 UTSW 12 72308390 missense possibly damaging 0.87
R7615:Rtn1 UTSW 12 72304143 missense probably damaging 1.00
R7697:Rtn1 UTSW 12 72408377 missense probably benign 0.32
R7748:Rtn1 UTSW 12 72216926 missense possibly damaging 0.53
R7754:Rtn1 UTSW 12 72308429 missense probably damaging 0.96
R7834:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
Z1177:Rtn1 UTSW 12 72308864 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCTTCTGCTGCTGTGATC -3'
(R):5'- CAGAAATTGAGCTGGTGTCAG -3'

Sequencing Primer
(F):5'- AGGCTCCATCTCCAGACGATG -3'
(R):5'- ATTGAGCTGGTGTCAGAGGACC -3'
Posted On2019-12-27