Incidental Mutation 'R7917:Ogdhl'
ID611015
Institutional Source Beutler Lab
Gene Symbol Ogdhl
Ensembl Gene ENSMUSG00000021913
Gene Nameoxoglutarate dehydrogenase-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7917 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32322019-32348151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32340709 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 584 (I584N)
Ref Sequence ENSEMBL: ENSMUSP00000022480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022480] [ENSMUST00000228529]
Predicted Effect probably benign
Transcript: ENSMUST00000022480
AA Change: I584N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022480
Gene: ENSMUSG00000021913
AA Change: I584N

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 44 81 2.7e-18 PFAM
Blast:Transket_pyr 118 154 8e-14 BLAST
Pfam:E1_dh 262 588 1.8e-88 PFAM
Transket_pyr 657 870 2.64e-51 SMART
Pfam:OxoGdeHyase_C 874 1019 8.3e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228529
AA Change: I565N

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to oxoglutarate dehydrogenase (OGDH) of the OGDH complex, which degrades glucose and glutamate. This gene encodes several isoforms, including some that appear to localize to mitochondria. The encoded protein down-regulates the AKT signaling cascade and can suppress the growth of cervical cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Ogdhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ogdhl APN 14 32333712 missense probably damaging 1.00
IGL00425:Ogdhl APN 14 32346490 missense probably damaging 1.00
IGL01509:Ogdhl APN 14 32337759 missense probably damaging 1.00
IGL01704:Ogdhl APN 14 32337631 splice site probably benign
IGL01760:Ogdhl APN 14 32339937 missense probably damaging 1.00
IGL02376:Ogdhl APN 14 32343318 missense probably damaging 1.00
IGL02508:Ogdhl APN 14 32345174 missense probably damaging 0.99
IGL02834:Ogdhl APN 14 32325946 missense probably damaging 1.00
IGL03100:Ogdhl APN 14 32342072 missense probably benign 0.03
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0207:Ogdhl UTSW 14 32342037 splice site probably null
R0322:Ogdhl UTSW 14 32337577 missense probably benign 0.09
R0357:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R0417:Ogdhl UTSW 14 32326979 missense probably damaging 1.00
R0677:Ogdhl UTSW 14 32339925 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1541:Ogdhl UTSW 14 32340667 missense possibly damaging 0.80
R1589:Ogdhl UTSW 14 32325865 missense probably benign
R1831:Ogdhl UTSW 14 32337527 missense probably damaging 0.99
R2059:Ogdhl UTSW 14 32332884 missense probably damaging 1.00
R2133:Ogdhl UTSW 14 32325934 missense probably benign
R2179:Ogdhl UTSW 14 32335345 missense probably damaging 0.99
R2656:Ogdhl UTSW 14 32332826 missense possibly damaging 0.89
R3607:Ogdhl UTSW 14 32335361 missense probably damaging 1.00
R4617:Ogdhl UTSW 14 32325885 missense probably benign
R4668:Ogdhl UTSW 14 32332536 missense probably benign 0.00
R5419:Ogdhl UTSW 14 32339224 missense probably damaging 1.00
R5575:Ogdhl UTSW 14 32325847 missense possibly damaging 0.60
R5793:Ogdhl UTSW 14 32332773 missense probably damaging 0.96
R5812:Ogdhl UTSW 14 32332865 missense probably damaging 1.00
R5990:Ogdhl UTSW 14 32327114 missense possibly damaging 0.77
R6224:Ogdhl UTSW 14 32342061 missense probably benign 0.09
R7834:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7837:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R7920:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
Z1177:Ogdhl UTSW 14 32343280 missense probably damaging 1.00
Z1177:Ogdhl UTSW 14 32346411 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCATGGCATCCTTGTGAACC -3'
(R):5'- ACTCTTGCTCTAAGGCCACC -3'

Sequencing Primer
(F):5'- TTGTGAACCAAGAAACAGAGTTC -3'
(R):5'- TGGCCTGCCTCCACCTG -3'
Posted On2019-12-27