Mutagenetix > Incidental Mutation

Incidental Mutation 'R0685:Gstm5'

61105

Institutional Source

Beutler Lab

Gene Symbol

Gstm5

Ensembl Gene

ENSMUSG00000004032

Gene Name

glutathione S-transferase, mu 5

Synonyms

MMRRC Submission

038870-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0685 (G1)

Quality Score

135

Status

Validated

Chromosome

Chromosomal Location

107895821-107898686 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107897319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 73 (I73N)

Ref Sequence

ENSEMBL: ENSMUSP00000129426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000167387] [ENSMUST00000169365] [ENSMUST00000172247] [ENSMUST00000167523] [ENSMUST00000170058]

AlphaFold

P48774

Predicted Effect

probably damaging
Transcript: ENSMUST00000004134
AA Change: I73N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: I73N

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	85	4e-23	PFAM
Pfam:GST_C	107	195	1.5e-19	PFAM
Pfam:GST_C_3	113	193	2.9e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000037375

SMART Domains

Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

Domain	Start	End	E-Value	Type
Pfam:PTB	28	155	3.7e-40	PFAM
low complexity region	204	214	N/A	INTRINSIC
low complexity region	230	247	N/A	INTRINSIC
low complexity region	273	285	N/A	INTRINSIC
SH3	460	515	5.19e-15	SMART
PDB:2E8M\|A	516	582	3e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131345

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133570

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137970

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146337

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152663

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163675

Predicted Effect

probably damaging
Transcript: ENSMUST00000167387
AA Change: I7N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032
AA Change: I7N

Domain	Start	End	E-Value	Type
Pfam:GST_C	41	129	2.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169365
AA Change: I7N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032
AA Change: I7N

Domain	Start	End	E-Value	Type
Pfam:GST_C	41	129	2.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172247
AA Change: I73N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: I73N

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	85	2.1e-21	PFAM
Pfam:GST_C	107	193	2.2e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167523

SMART Domains

Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	67	6.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170058

SMART Domains

Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032

Domain	Start	End	E-Value	Type
Pfam:GST_N	6	55	3.4e-9	PFAM

Meta Mutation Damage Score

0.8539

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Chl1	G	A	6: 103,708,542		probably null	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Il15	T	C	8: 82,337,559		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smc1b	T	C	15: 85,070,820	D1077G	possibly damaging	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tinag	C	A	9: 76,952,003	W441L	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Uhrf1	G	T	17: 56,310,742	V155L	probably damaging	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Gstm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Gstm5	APN	3	107897558	missense	probably benign	0.11
IGL02219:Gstm5	APN	3	107898031	missense	probably damaging	1.00
R2364:Gstm5	UTSW	3	107896371	missense	probably benign	0.00
R3836:Gstm5	UTSW	3	107896362	missense	probably benign	0.00
R4600:Gstm5	UTSW	3	107897986	missense	probably damaging	1.00
R5097:Gstm5	UTSW	3	107895942	start gained	probably benign
R5369:Gstm5	UTSW	3	107898466	missense	probably damaging	1.00
R5415:Gstm5	UTSW	3	107897495	missense	probably damaging	1.00
R5689:Gstm5	UTSW	3	107896665	missense	probably damaging	0.97
R5832:Gstm5	UTSW	3	107897537	missense	probably benign	0.01
R5988:Gstm5	UTSW	3	107895954	start codon destroyed	probably benign
R7329:Gstm5	UTSW	3	107896331	missense	possibly damaging	0.69
R7546:Gstm5	UTSW	3	107897294	missense	probably damaging	1.00
R9222:Gstm5	UTSW	3	107897318	missense	probably benign	0.09
X0020:Gstm5	UTSW	3	107895966	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- ACACACAGGATTAAGCACCCTTGTC -3'
(R):5'- GCGGAAGTCCATGATCTGGTTCTC -3'

Sequencing Primer
(F):5'- CAGGATTAAGCACCCTTGTCTAGAG -3'
(R):5'- CCATGATCTGGTTCTCCATGATG -3'

Posted On

2013-07-30