Incidental Mutation 'R7919:Pth2r'
ID611083
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7919 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65351563 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 292 (W292L)
Ref Sequence ENSEMBL: ENSMUSP00000027083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083]
Predicted Effect probably damaging
Transcript: ENSMUST00000027083
AA Change: W292L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: W292L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,757 F1189V probably damaging Het
Abcb4 T G 5: 8,934,203 S644R probably benign Het
Adra2a A G 19: 54,046,228 E5G probably benign Het
Ankrd1 A T 19: 36,115,522 V201D possibly damaging Het
Ano9 A T 7: 141,103,201 V598E probably damaging Het
Apob T A 12: 8,001,885 M1150K possibly damaging Het
BC005624 A T 2: 30,974,020 I187N probably damaging Het
Ccl9 T C 11: 83,576,431 E31G probably benign Het
Cnnm4 T A 1: 36,471,938 D82E probably benign Het
Coq10b T C 1: 55,052,854 probably benign Het
Cyb561 T C 11: 105,940,109 N50S probably benign Het
Dctn4 G T 18: 60,546,276 A223S probably benign Het
Dysf A G 6: 84,137,398 Y1223C probably damaging Het
Eed C T 7: 89,980,814 probably benign Het
Eef1g T A 19: 8,977,374 V305E probably benign Het
Eif4ebp2 C A 10: 61,434,993 A86S probably benign Het
Ermp1 T C 19: 29,632,388 probably null Het
Gm5065 A T 7: 5,359,508 K46M probably damaging Het
Hid1 T C 11: 115,358,995 Y198C probably damaging Het
Hoxd1 C A 2: 74,763,472 A124E probably benign Het
Hyal5 G A 6: 24,891,348 C387Y probably damaging Het
Il11 A G 7: 4,776,000 S103P probably damaging Het
Lmtk3 A C 7: 45,786,903 I128L possibly damaging Het
Lrrc4b G T 7: 44,444,892 probably benign Het
Magel2 T A 7: 62,378,368 I340N possibly damaging Het
Mfsd14a A T 3: 116,648,551 F71I possibly damaging Het
Mgarp A G 3: 51,389,066 S172P probably benign Het
Mug1 T C 6: 121,870,652 probably null Het
Naa15 G T 3: 51,463,267 E651* probably null Het
Ndfip2 T C 14: 105,292,241 V168A probably benign Het
Nfil3 A G 13: 52,967,932 V312A possibly damaging Het
Nrap T C 19: 56,350,297 I953V probably benign Het
Ntrk1 T A 3: 87,779,734 K706* probably null Het
Nuf2 A T 1: 169,525,329 F36I probably benign Het
Olfr259 T C 2: 87,107,517 Y290C probably damaging Het
Olfr573-ps1 T A 7: 102,941,918 T220S possibly damaging Het
Pcdh8 T G 14: 79,768,661 T821P possibly damaging Het
Ptch2 C A 4: 117,105,027 probably null Het
Ptdss1 A G 13: 66,933,655 I50V probably benign Het
Ptprd G A 4: 75,982,644 T825M probably damaging Het
Ptprk T C 10: 28,573,389 Y987H probably damaging Het
Qser1 T C 2: 104,776,234 E1470G probably damaging Het
Rab11fip3 T C 17: 26,068,258 E307G possibly damaging Het
Rims2 A G 15: 39,681,079 Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 probably null Het
Slc15a1 T A 14: 121,480,733 K245* probably null Het
Snx11 T A 11: 96,769,206 E219V possibly damaging Het
Sox21 C A 14: 118,235,317 E107* probably null Het
Spink5 T A 18: 43,999,821 H501Q probably benign Het
Stard5 C T 7: 83,636,776 T103M probably damaging Het
Stfa2l1 A T 16: 36,156,833 probably benign Het
Sult1c1 A C 17: 53,964,048 V185G probably damaging Het
Svs2 A G 2: 164,237,580 S136P possibly damaging Het
Sytl3 T A 17: 6,715,375 probably null Het
Tc2n C T 12: 101,652,853 V349I possibly damaging Het
Tln1 A G 4: 43,554,309 V271A probably benign Het
Tmem260 T A 14: 48,509,062 S446R probably benign Het
Trim30a T C 7: 104,435,595 D136G probably benign Het
Uhrf1bp1l C T 10: 89,816,106 T1381I probably benign Het
Ulk4 A T 9: 121,044,819 I1182N possibly damaging Het
Unc50 T G 1: 37,437,296 I179S possibly damaging Het
Upb1 T A 10: 75,412,833 Y57* probably null Het
Usp34 C T 11: 23,446,614 T2349I Het
Vmn1r71 A G 7: 10,748,350 V137A possibly damaging Het
Vmn1r85 T C 7: 13,084,771 I149V probably benign Het
Vmn2r118 A G 17: 55,593,242 L554P probably damaging Het
Wdr4 C G 17: 31,499,808 probably null Het
Zbbx A T 3: 75,078,474 S424T possibly damaging Het
Zfp207 C G 11: 80,391,900 P246A probably damaging Het
Zfp414 T A 17: 33,629,988 Y65* probably null Het
Zfp827 T C 8: 79,186,350 L1073P probably damaging Het
Zfp986 A G 4: 145,899,121 K117R possibly damaging Het
Zgrf1 T A 3: 127,563,431 Y769N probably damaging Het
Zufsp A T 10: 33,919,319 I547N unknown Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R8061:Pth2r UTSW 1 65343501 missense possibly damaging 0.64
Z1176:Pth2r UTSW 1 65363308 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTCAAACTAACAAGAGGGCATTAGG -3'
(R):5'- GGCAACGTGTGAGCATCTAC -3'

Sequencing Primer
(F):5'- AAGAGGGCATTAGGTCCACGTTTC -3'
(R):5'- ACGTGTGAGCATCTACCACTG -3'
Posted On2019-12-27