Incidental Mutation 'R7919:2410089E03Rik'
ID611138
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7919 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8203757 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 1189 (F1189V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably damaging
Transcript: ENSMUST00000110617
AA Change: F1189V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: F1189V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,934,203 S644R probably benign Het
Adra2a A G 19: 54,046,228 E5G probably benign Het
Ankrd1 A T 19: 36,115,522 V201D possibly damaging Het
Ano9 A T 7: 141,103,201 V598E probably damaging Het
Apob T A 12: 8,001,885 M1150K possibly damaging Het
BC005624 A T 2: 30,974,020 I187N probably damaging Het
Ccl9 T C 11: 83,576,431 E31G probably benign Het
Cnnm4 T A 1: 36,471,938 D82E probably benign Het
Coq10b T C 1: 55,052,854 probably benign Het
Cyb561 T C 11: 105,940,109 N50S probably benign Het
Dctn4 G T 18: 60,546,276 A223S probably benign Het
Dysf A G 6: 84,137,398 Y1223C probably damaging Het
Eed C T 7: 89,980,814 probably benign Het
Eef1g T A 19: 8,977,374 V305E probably benign Het
Eif4ebp2 C A 10: 61,434,993 A86S probably benign Het
Ermp1 T C 19: 29,632,388 probably null Het
Gm5065 A T 7: 5,359,508 K46M probably damaging Het
Hid1 T C 11: 115,358,995 Y198C probably damaging Het
Hoxd1 C A 2: 74,763,472 A124E probably benign Het
Hyal5 G A 6: 24,891,348 C387Y probably damaging Het
Il11 A G 7: 4,776,000 S103P probably damaging Het
Lmtk3 A C 7: 45,786,903 I128L possibly damaging Het
Lrrc4b G T 7: 44,444,892 probably benign Het
Magel2 T A 7: 62,378,368 I340N possibly damaging Het
Mfsd14a A T 3: 116,648,551 F71I possibly damaging Het
Mgarp A G 3: 51,389,066 S172P probably benign Het
Mug1 T C 6: 121,870,652 probably null Het
Naa15 G T 3: 51,463,267 E651* probably null Het
Ndfip2 T C 14: 105,292,241 V168A probably benign Het
Nfil3 A G 13: 52,967,932 V312A possibly damaging Het
Nrap T C 19: 56,350,297 I953V probably benign Het
Ntrk1 T A 3: 87,779,734 K706* probably null Het
Nuf2 A T 1: 169,525,329 F36I probably benign Het
Olfr259 T C 2: 87,107,517 Y290C probably damaging Het
Olfr573-ps1 T A 7: 102,941,918 T220S possibly damaging Het
Pcdh8 T G 14: 79,768,661 T821P possibly damaging Het
Ptch2 C A 4: 117,105,027 probably null Het
Ptdss1 A G 13: 66,933,655 I50V probably benign Het
Pth2r G T 1: 65,351,563 W292L probably damaging Het
Ptprd G A 4: 75,982,644 T825M probably damaging Het
Ptprk T C 10: 28,573,389 Y987H probably damaging Het
Qser1 T C 2: 104,776,234 E1470G probably damaging Het
Rab11fip3 T C 17: 26,068,258 E307G possibly damaging Het
Rims2 A G 15: 39,681,079 Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 probably null Het
Slc15a1 T A 14: 121,480,733 K245* probably null Het
Snx11 T A 11: 96,769,206 E219V possibly damaging Het
Sox21 C A 14: 118,235,317 E107* probably null Het
Spink5 T A 18: 43,999,821 H501Q probably benign Het
Stard5 C T 7: 83,636,776 T103M probably damaging Het
Stfa2l1 A T 16: 36,156,833 probably benign Het
Sult1c1 A C 17: 53,964,048 V185G probably damaging Het
Svs2 A G 2: 164,237,580 S136P possibly damaging Het
Sytl3 T A 17: 6,715,375 probably null Het
Tc2n C T 12: 101,652,853 V349I possibly damaging Het
Tln1 A G 4: 43,554,309 V271A probably benign Het
Tmem260 T A 14: 48,509,062 S446R probably benign Het
Trim30a T C 7: 104,435,595 D136G probably benign Het
Uhrf1bp1l C T 10: 89,816,106 T1381I probably benign Het
Ulk4 A T 9: 121,044,819 I1182N possibly damaging Het
Unc50 T G 1: 37,437,296 I179S possibly damaging Het
Upb1 T A 10: 75,412,833 Y57* probably null Het
Usp34 C T 11: 23,446,614 T2349I Het
Vmn1r71 A G 7: 10,748,350 V137A possibly damaging Het
Vmn1r85 T C 7: 13,084,771 I149V probably benign Het
Vmn2r118 A G 17: 55,593,242 L554P probably damaging Het
Wdr4 C G 17: 31,499,808 probably null Het
Zbbx A T 3: 75,078,474 S424T possibly damaging Het
Zfp207 C G 11: 80,391,900 P246A probably damaging Het
Zfp414 T A 17: 33,629,988 Y65* probably null Het
Zfp827 T C 8: 79,186,350 L1073P probably damaging Het
Zfp986 A G 4: 145,899,121 K117R possibly damaging Het
Zgrf1 T A 3: 127,563,431 Y769N probably damaging Het
Zufsp A T 10: 33,919,319 I547N unknown Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7958:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7984:2410089E03Rik UTSW 15 8269706 missense unknown
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGAGTCTTCTCTCAGTGAAAGTTG -3'
(R):5'- ACCTCATGGTGGCATCTCAG -3'

Sequencing Primer
(F):5'- TCTGCTTTTTAAAAATGGCCTGG -3'
(R):5'- AGCCCAAGATTTATGGTTCACAGG -3'
Posted On2019-12-27