Incidental Mutation 'R0685:Nap1l5'
ID 61115
Institutional Source Beutler Lab
Gene Symbol Nap1l5
Ensembl Gene ENSMUSG00000055430
Gene Name nucleosome assembly protein 1-like 5
Synonyms 1110020M21Rik
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R0685 (G1)
Quality Score 165
Status Validated
Chromosome 6
Chromosomal Location 58882218-58884061 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58883757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 66 (C66S)
Ref Sequence ENSEMBL: ENSMUSP00000062780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000059539] [ENSMUST00000204629] [ENSMUST00000205101]
AlphaFold Q9JJF0
Predicted Effect probably benign
Transcript: ENSMUST00000031823
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041401
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059539
AA Change: C66S

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062780
Gene: ENSMUSG00000055430
AA Change: C66S

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Pfam:NAP 66 154 3.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131132
Predicted Effect probably benign
Transcript: ENSMUST00000204629
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205101
SMART Domains Protein: ENSMUSP00000145365
Gene: ENSMUSG00000055430

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 58 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205139
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity to nucleosome assembly factors, but may be localized to the cytoplasm rather than the nucleus. Expression of this gene is downregulated in hepatocellular carcinomas. This gene is located within a differentially methylated region (DMR) and is imprinted and paternally expressed. There is a related pseudogene on chromosome 4. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,469,337 (GRCm39) D17G probably damaging Het
Abi3bp A G 16: 56,353,316 (GRCm39) T82A possibly damaging Het
Adgre4 A C 17: 56,099,035 (GRCm39) E180D probably benign Het
Ankrd28 G A 14: 31,465,407 (GRCm39) probably benign Het
Aoc3 A G 11: 101,227,273 (GRCm39) D382G possibly damaging Het
Apob C A 12: 8,060,742 (GRCm39) R3075S probably benign Het
Aqr A G 2: 113,971,458 (GRCm39) F459S probably damaging Het
Bcr T C 10: 74,967,475 (GRCm39) W570R probably damaging Het
Bloc1s5 C T 13: 38,787,895 (GRCm39) R163K probably benign Het
Bod1 A T 11: 31,619,267 (GRCm39) N101K possibly damaging Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Chl1 G A 6: 103,685,503 (GRCm39) probably null Het
Clstn1 G A 4: 149,731,312 (GRCm39) A885T probably benign Het
Cyp3a25 G T 5: 145,935,356 (GRCm39) P87T probably damaging Het
Dync1h1 T C 12: 110,623,626 (GRCm39) V3633A probably damaging Het
Dynlt5 T C 4: 102,859,735 (GRCm39) Y96H probably damaging Het
Elp4 C A 2: 105,622,622 (GRCm39) C241F possibly damaging Het
Fat4 T A 3: 39,055,327 (GRCm39) F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 (GRCm39) H381Y possibly damaging Het
Gm10577 G T 4: 100,877,515 (GRCm39) probably benign Het
Gm9955 G T 18: 24,842,314 (GRCm39) probably benign Het
Gstm5 T A 3: 107,804,635 (GRCm39) I73N probably damaging Het
Gypa T A 8: 81,223,331 (GRCm39) probably benign Het
Hectd2 T A 19: 36,546,831 (GRCm39) V64D probably damaging Het
Igkv10-95 T A 6: 68,657,543 (GRCm39) Y20N probably benign Het
Il15 T C 8: 83,064,188 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kiz C A 2: 146,697,978 (GRCm39) probably benign Het
Lcmt2 C A 2: 120,969,721 (GRCm39) S234I probably benign Het
Lilra5 A G 7: 4,244,956 (GRCm39) probably benign Het
Lin37 T C 7: 30,255,299 (GRCm39) E187G probably damaging Het
Lrrc37 T C 11: 103,507,714 (GRCm39) probably benign Het
Mcmdc2 T A 1: 9,982,039 (GRCm39) probably null Het
Mctp1 T C 13: 76,973,918 (GRCm39) probably null Het
Mdp1 C A 14: 55,896,726 (GRCm39) G112* probably null Het
Mmp15 T C 8: 96,098,762 (GRCm39) Y530H possibly damaging Het
Mtss2 T C 8: 111,454,029 (GRCm39) probably null Het
Muc5ac T C 7: 141,361,446 (GRCm39) S1586P probably benign Het
Ninl G T 2: 150,781,775 (GRCm39) Q1237K possibly damaging Het
Or5p70 A T 7: 107,994,470 (GRCm39) T48S possibly damaging Het
Or9m1b T C 2: 87,836,762 (GRCm39) E111G probably damaging Het
Orc6 T G 8: 86,027,783 (GRCm39) S37R possibly damaging Het
Papss1 A C 3: 131,288,854 (GRCm39) N119H possibly damaging Het
Phf13 A T 4: 152,076,069 (GRCm39) F278I probably damaging Het
Pole2 C A 12: 69,258,187 (GRCm39) A239S probably damaging Het
Ppt2 T C 17: 34,845,546 (GRCm39) D75G probably damaging Het
Psd2 A G 18: 36,136,044 (GRCm39) D443G possibly damaging Het
Psen1 C A 12: 83,761,594 (GRCm39) S132* probably null Het
Psme4 A G 11: 30,828,415 (GRCm39) T1812A probably damaging Het
Rasgrf1 T C 9: 89,797,535 (GRCm39) probably benign Het
Reep3 A G 10: 66,857,518 (GRCm39) probably benign Het
Rexo4 A T 2: 26,848,586 (GRCm39) probably benign Het
Rnf6 A C 5: 146,148,468 (GRCm39) S183R probably damaging Het
Scai A T 2: 38,993,749 (GRCm39) M297K probably damaging Het
Scn9a A T 2: 66,313,843 (GRCm39) S1947R probably benign Het
Sema6c T C 3: 95,080,021 (GRCm39) C772R possibly damaging Het
Skint7 T C 4: 111,837,542 (GRCm39) S107P possibly damaging Het
Slc24a3 A G 2: 145,448,715 (GRCm39) N420D probably benign Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Smg7 G A 1: 152,742,399 (GRCm39) P82L probably damaging Het
Sp3 A C 2: 72,801,342 (GRCm39) F268V probably damaging Het
Srms T C 2: 180,854,426 (GRCm39) D47G probably benign Het
Ss18 A C 18: 14,784,238 (GRCm39) M150R probably damaging Het
Taf5 G A 19: 47,063,293 (GRCm39) R281Q probably benign Het
Tars1 T C 15: 11,385,259 (GRCm39) K644R probably benign Het
Tinag C A 9: 76,859,285 (GRCm39) W441L probably damaging Het
Tmtc1 T C 6: 148,312,738 (GRCm39) S244G probably benign Het
Tpr T C 1: 150,309,476 (GRCm39) V1670A possibly damaging Het
Trpv3 A G 11: 73,187,640 (GRCm39) probably benign Het
Uhrf1 G T 17: 56,617,742 (GRCm39) V155L probably damaging Het
Ush2a G A 1: 188,132,475 (GRCm39) C899Y probably damaging Het
Vmn2r115 G A 17: 23,578,249 (GRCm39) R574H probably benign Het
Vmn2r63 T C 7: 42,577,434 (GRCm39) D368G probably benign Het
Vps13a A G 19: 16,758,105 (GRCm39) V10A probably damaging Het
Wbp11 A G 6: 136,791,636 (GRCm39) probably benign Het
Zcwpw1 A G 5: 137,797,854 (GRCm39) D145G probably benign Het
Zfp607a G A 7: 27,577,901 (GRCm39) V324I probably damaging Het
Zfp618 A G 4: 63,052,011 (GRCm39) I931V probably benign Het
Zfp821 T C 8: 110,451,174 (GRCm39) V389A possibly damaging Het
Zfp976 T A 7: 42,263,141 (GRCm39) H232L probably damaging Het
Other mutations in Nap1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0027:Nap1l5 UTSW 6 58,883,810 (GRCm39) missense probably damaging 1.00
R5524:Nap1l5 UTSW 6 58,883,763 (GRCm39) missense possibly damaging 0.81
R7890:Nap1l5 UTSW 6 58,883,873 (GRCm39) missense probably damaging 1.00
R7896:Nap1l5 UTSW 6 58,883,505 (GRCm39) missense probably damaging 0.99
R9419:Nap1l5 UTSW 6 58,883,952 (GRCm39) start codon destroyed probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGGGATTTATCACCTGTCAGCTTGC -3'
(R):5'- TTTGCCGCATCTTCAGACGCAC -3'

Sequencing Primer
(F):5'- cctcttcttcctcctcctcc -3'
(R):5'- TGGACCAGCTCTATTGCAGAC -3'
Posted On 2013-07-30