Incidental Mutation 'R7920:Bcl2'
ID611159
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene NameB cell leukemia/lymphoma 2
SynonymsD830018M01Rik, C430015F12Rik, Bcl-2
Accession Numbers

MGI: 88138

Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location106538178-106714274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106543356 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 207 (F207V)
Ref Sequence ENSEMBL: ENSMUSP00000108371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112751
AA Change: F207V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329
AA Change: F207V

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106712358 missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106543307 missense probably benign 0.24
Croce UTSW 1 106543281 missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106712694 missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0965:Bcl2 UTSW 1 106712291 missense probably benign 0.13
R1756:Bcl2 UTSW 1 106712392 missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106712436 missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106712608 missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106712646 missense probably benign 0.00
R6864:Bcl2 UTSW 1 106543281 missense probably damaging 1.00
R7576:Bcl2 UTSW 1 106712423 missense possibly damaging 0.64
R7837:Bcl2 UTSW 1 106543356 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGATTCGACCATTTGCC -3'
(R):5'- AGGTCTGAAGTTACCTGGCATG -3'

Sequencing Primer
(F):5'- GATTCGACCATTTGCCTGAATG -3'
(R):5'- AGTTACCTGGCATGCAGGG -3'
Posted On2019-12-27