Incidental Mutation 'R0685:Chl1'
ID 61116
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Name cell adhesion molecule L1-like
Synonyms A530023M13Rik, close homolog of L1, LICAM2, CALL
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R0685 (G1)
Quality Score 152
Status Validated
Chromosome 6
Chromosomal Location 103487372-103709999 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 103685503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
AlphaFold P70232
Predicted Effect probably null
Transcript: ENSMUST00000066905
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203830
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203912
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,469,337 (GRCm39) D17G probably damaging Het
Abi3bp A G 16: 56,353,316 (GRCm39) T82A possibly damaging Het
Adgre4 A C 17: 56,099,035 (GRCm39) E180D probably benign Het
Ankrd28 G A 14: 31,465,407 (GRCm39) probably benign Het
Aoc3 A G 11: 101,227,273 (GRCm39) D382G possibly damaging Het
Apob C A 12: 8,060,742 (GRCm39) R3075S probably benign Het
Aqr A G 2: 113,971,458 (GRCm39) F459S probably damaging Het
Bcr T C 10: 74,967,475 (GRCm39) W570R probably damaging Het
Bloc1s5 C T 13: 38,787,895 (GRCm39) R163K probably benign Het
Bod1 A T 11: 31,619,267 (GRCm39) N101K possibly damaging Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Clstn1 G A 4: 149,731,312 (GRCm39) A885T probably benign Het
Cyp3a25 G T 5: 145,935,356 (GRCm39) P87T probably damaging Het
Dync1h1 T C 12: 110,623,626 (GRCm39) V3633A probably damaging Het
Dynlt5 T C 4: 102,859,735 (GRCm39) Y96H probably damaging Het
Elp4 C A 2: 105,622,622 (GRCm39) C241F possibly damaging Het
Fat4 T A 3: 39,055,327 (GRCm39) F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 (GRCm39) H381Y possibly damaging Het
Gm10577 G T 4: 100,877,515 (GRCm39) probably benign Het
Gm9955 G T 18: 24,842,314 (GRCm39) probably benign Het
Gstm5 T A 3: 107,804,635 (GRCm39) I73N probably damaging Het
Gypa T A 8: 81,223,331 (GRCm39) probably benign Het
Hectd2 T A 19: 36,546,831 (GRCm39) V64D probably damaging Het
Igkv10-95 T A 6: 68,657,543 (GRCm39) Y20N probably benign Het
Il15 T C 8: 83,064,188 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kiz C A 2: 146,697,978 (GRCm39) probably benign Het
Lcmt2 C A 2: 120,969,721 (GRCm39) S234I probably benign Het
Lilra5 A G 7: 4,244,956 (GRCm39) probably benign Het
Lin37 T C 7: 30,255,299 (GRCm39) E187G probably damaging Het
Lrrc37 T C 11: 103,507,714 (GRCm39) probably benign Het
Mcmdc2 T A 1: 9,982,039 (GRCm39) probably null Het
Mctp1 T C 13: 76,973,918 (GRCm39) probably null Het
Mdp1 C A 14: 55,896,726 (GRCm39) G112* probably null Het
Mmp15 T C 8: 96,098,762 (GRCm39) Y530H possibly damaging Het
Mtss2 T C 8: 111,454,029 (GRCm39) probably null Het
Muc5ac T C 7: 141,361,446 (GRCm39) S1586P probably benign Het
Nap1l5 A T 6: 58,883,757 (GRCm39) C66S possibly damaging Het
Ninl G T 2: 150,781,775 (GRCm39) Q1237K possibly damaging Het
Or5p70 A T 7: 107,994,470 (GRCm39) T48S possibly damaging Het
Or9m1b T C 2: 87,836,762 (GRCm39) E111G probably damaging Het
Orc6 T G 8: 86,027,783 (GRCm39) S37R possibly damaging Het
Papss1 A C 3: 131,288,854 (GRCm39) N119H possibly damaging Het
Phf13 A T 4: 152,076,069 (GRCm39) F278I probably damaging Het
Pole2 C A 12: 69,258,187 (GRCm39) A239S probably damaging Het
Ppt2 T C 17: 34,845,546 (GRCm39) D75G probably damaging Het
Psd2 A G 18: 36,136,044 (GRCm39) D443G possibly damaging Het
Psen1 C A 12: 83,761,594 (GRCm39) S132* probably null Het
Psme4 A G 11: 30,828,415 (GRCm39) T1812A probably damaging Het
Rasgrf1 T C 9: 89,797,535 (GRCm39) probably benign Het
Reep3 A G 10: 66,857,518 (GRCm39) probably benign Het
Rexo4 A T 2: 26,848,586 (GRCm39) probably benign Het
Rnf6 A C 5: 146,148,468 (GRCm39) S183R probably damaging Het
Scai A T 2: 38,993,749 (GRCm39) M297K probably damaging Het
Scn9a A T 2: 66,313,843 (GRCm39) S1947R probably benign Het
Sema6c T C 3: 95,080,021 (GRCm39) C772R possibly damaging Het
Skint7 T C 4: 111,837,542 (GRCm39) S107P possibly damaging Het
Slc24a3 A G 2: 145,448,715 (GRCm39) N420D probably benign Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Smg7 G A 1: 152,742,399 (GRCm39) P82L probably damaging Het
Sp3 A C 2: 72,801,342 (GRCm39) F268V probably damaging Het
Srms T C 2: 180,854,426 (GRCm39) D47G probably benign Het
Ss18 A C 18: 14,784,238 (GRCm39) M150R probably damaging Het
Taf5 G A 19: 47,063,293 (GRCm39) R281Q probably benign Het
Tars1 T C 15: 11,385,259 (GRCm39) K644R probably benign Het
Tinag C A 9: 76,859,285 (GRCm39) W441L probably damaging Het
Tmtc1 T C 6: 148,312,738 (GRCm39) S244G probably benign Het
Tpr T C 1: 150,309,476 (GRCm39) V1670A possibly damaging Het
Trpv3 A G 11: 73,187,640 (GRCm39) probably benign Het
Uhrf1 G T 17: 56,617,742 (GRCm39) V155L probably damaging Het
Ush2a G A 1: 188,132,475 (GRCm39) C899Y probably damaging Het
Vmn2r115 G A 17: 23,578,249 (GRCm39) R574H probably benign Het
Vmn2r63 T C 7: 42,577,434 (GRCm39) D368G probably benign Het
Vps13a A G 19: 16,758,105 (GRCm39) V10A probably damaging Het
Wbp11 A G 6: 136,791,636 (GRCm39) probably benign Het
Zcwpw1 A G 5: 137,797,854 (GRCm39) D145G probably benign Het
Zfp607a G A 7: 27,577,901 (GRCm39) V324I probably damaging Het
Zfp618 A G 4: 63,052,011 (GRCm39) I931V probably benign Het
Zfp821 T C 8: 110,451,174 (GRCm39) V389A possibly damaging Het
Zfp976 T A 7: 42,263,141 (GRCm39) H232L probably damaging Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103,670,022 (GRCm39) missense probably benign 0.08
IGL00786:Chl1 APN 6 103,652,106 (GRCm39) missense probably damaging 1.00
IGL00959:Chl1 APN 6 103,686,211 (GRCm39) splice site probably null
IGL01109:Chl1 APN 6 103,692,354 (GRCm39) missense probably damaging 1.00
IGL01354:Chl1 APN 6 103,642,814 (GRCm39) missense probably benign 0.01
IGL01367:Chl1 APN 6 103,706,186 (GRCm39) missense probably benign 0.42
IGL01371:Chl1 APN 6 103,692,325 (GRCm39) missense probably damaging 1.00
IGL01599:Chl1 APN 6 103,685,445 (GRCm39) missense probably benign 0.34
IGL01724:Chl1 APN 6 103,626,534 (GRCm39) missense probably damaging 1.00
IGL02001:Chl1 APN 6 103,619,017 (GRCm39) missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103,675,185 (GRCm39) missense probably benign 0.39
IGL02122:Chl1 APN 6 103,652,098 (GRCm39) missense probably benign 0.39
IGL02340:Chl1 APN 6 103,675,086 (GRCm39) missense probably damaging 1.00
IGL02420:Chl1 APN 6 103,692,330 (GRCm39) missense probably damaging 1.00
IGL02421:Chl1 APN 6 103,694,541 (GRCm39) missense probably damaging 1.00
IGL02429:Chl1 APN 6 103,641,770 (GRCm39) unclassified probably benign
IGL02825:Chl1 APN 6 103,645,764 (GRCm39) missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103,618,949 (GRCm39) missense probably damaging 1.00
IGL03169:Chl1 APN 6 103,642,928 (GRCm39) missense probably damaging 1.00
IGL03185:Chl1 APN 6 103,642,824 (GRCm39) missense probably damaging 1.00
IGL03189:Chl1 APN 6 103,660,168 (GRCm39) missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103,652,058 (GRCm39) missense probably damaging 1.00
IGL03404:Chl1 APN 6 103,670,052 (GRCm39) missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103,668,628 (GRCm39) missense probably benign 0.01
R0060:Chl1 UTSW 6 103,688,019 (GRCm39) splice site probably benign
R0060:Chl1 UTSW 6 103,688,019 (GRCm39) splice site probably benign
R0062:Chl1 UTSW 6 103,726,613 (GRCm39) missense unknown
R0314:Chl1 UTSW 6 103,624,262 (GRCm39) missense probably damaging 1.00
R0322:Chl1 UTSW 6 103,678,844 (GRCm39) splice site probably benign
R0702:Chl1 UTSW 6 103,683,583 (GRCm39) missense probably damaging 1.00
R1056:Chl1 UTSW 6 103,652,038 (GRCm39) missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103,670,140 (GRCm39) missense probably benign 0.05
R1483:Chl1 UTSW 6 103,624,248 (GRCm39) missense probably damaging 1.00
R1571:Chl1 UTSW 6 103,685,445 (GRCm39) missense probably benign 0.34
R1620:Chl1 UTSW 6 103,667,203 (GRCm39) missense probably benign 0.00
R1645:Chl1 UTSW 6 103,660,141 (GRCm39) missense probably benign 0.06
R1773:Chl1 UTSW 6 103,624,292 (GRCm39) critical splice donor site probably null
R1852:Chl1 UTSW 6 103,676,120 (GRCm39) splice site probably null
R1891:Chl1 UTSW 6 103,691,544 (GRCm39) missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103,692,362 (GRCm39) critical splice donor site probably null
R2147:Chl1 UTSW 6 103,692,362 (GRCm39) critical splice donor site probably null
R2148:Chl1 UTSW 6 103,692,362 (GRCm39) critical splice donor site probably null
R2163:Chl1 UTSW 6 103,688,192 (GRCm39) missense probably damaging 1.00
R2291:Chl1 UTSW 6 103,692,354 (GRCm39) missense probably damaging 1.00
R2920:Chl1 UTSW 6 103,672,304 (GRCm39) missense probably damaging 1.00
R3611:Chl1 UTSW 6 103,675,116 (GRCm39) missense probably damaging 1.00
R3979:Chl1 UTSW 6 103,692,245 (GRCm39) nonsense probably null
R4987:Chl1 UTSW 6 103,651,938 (GRCm39) missense probably damaging 1.00
R5266:Chl1 UTSW 6 103,677,504 (GRCm39) missense probably damaging 1.00
R5478:Chl1 UTSW 6 103,660,182 (GRCm39) missense probably damaging 1.00
R5523:Chl1 UTSW 6 103,685,675 (GRCm39) missense probably damaging 1.00
R5887:Chl1 UTSW 6 103,694,565 (GRCm39) missense probably benign 0.00
R5986:Chl1 UTSW 6 103,686,152 (GRCm39) missense probably benign 0.45
R6101:Chl1 UTSW 6 103,669,993 (GRCm39) missense probably damaging 0.96
R6179:Chl1 UTSW 6 103,660,204 (GRCm39) missense probably benign 0.38
R6366:Chl1 UTSW 6 103,706,197 (GRCm39) missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103,667,220 (GRCm39) missense probably damaging 1.00
R6824:Chl1 UTSW 6 103,691,510 (GRCm39) missense probably damaging 1.00
R6913:Chl1 UTSW 6 103,642,909 (GRCm39) nonsense probably null
R7097:Chl1 UTSW 6 103,683,409 (GRCm39) missense probably damaging 1.00
R7122:Chl1 UTSW 6 103,683,409 (GRCm39) missense probably damaging 1.00
R7198:Chl1 UTSW 6 103,683,517 (GRCm39) missense probably damaging 1.00
R7203:Chl1 UTSW 6 103,668,635 (GRCm39) missense probably benign 0.13
R7527:Chl1 UTSW 6 103,688,162 (GRCm39) missense probably damaging 1.00
R7625:Chl1 UTSW 6 103,706,086 (GRCm39) missense probably damaging 1.00
R7667:Chl1 UTSW 6 103,672,456 (GRCm39) missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103,668,613 (GRCm39) missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103,688,063 (GRCm39) missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103,668,635 (GRCm39) missense probably benign 0.01
R7863:Chl1 UTSW 6 103,683,475 (GRCm39) missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103,667,224 (GRCm39) missense probably benign 0.22
R7998:Chl1 UTSW 6 103,706,250 (GRCm39) missense probably benign 0.01
R8044:Chl1 UTSW 6 103,683,593 (GRCm39) missense probably damaging 0.96
R8059:Chl1 UTSW 6 103,651,948 (GRCm39) missense probably damaging 0.97
R8462:Chl1 UTSW 6 103,706,130 (GRCm39) missense probably benign 0.11
R8558:Chl1 UTSW 6 103,685,390 (GRCm39) missense probably benign 0.14
R8827:Chl1 UTSW 6 103,670,111 (GRCm39) missense probably benign
R8865:Chl1 UTSW 6 103,685,822 (GRCm39) missense probably damaging 0.99
R8939:Chl1 UTSW 6 103,642,868 (GRCm39) missense probably damaging 1.00
R9092:Chl1 UTSW 6 103,645,815 (GRCm39) unclassified probably benign
Z1177:Chl1 UTSW 6 103,674,910 (GRCm39) start gained probably benign
Z1177:Chl1 UTSW 6 103,670,057 (GRCm39) nonsense probably null
Z1191:Chl1 UTSW 6 103,660,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCATTCCAGTGGACATGGC -3'
(R):5'- GGGAAGGAACCATTCCAGAGTTTCG -3'

Sequencing Primer
(F):5'- TCCTCGGGATCTGAAGATCAC -3'
(R):5'- CGCTGTCCTGAAAACCTTAGAATG -3'
Posted On 2013-07-30