Incidental Mutation 'R0685:Chl1'
ID61116
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R0685 (G1)
Quality Score152
Status Validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 103708542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect probably null
Transcript: ENSMUST00000066905
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203830
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203912
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 splice site probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5523:Chl1 UTSW 6 103708714 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R5986:Chl1 UTSW 6 103709191 missense probably benign 0.45
R6101:Chl1 UTSW 6 103693032 missense probably damaging 0.96
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
R7097:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7122:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7198:Chl1 UTSW 6 103706556 missense probably damaging 1.00
R7203:Chl1 UTSW 6 103691674 missense probably benign 0.13
R7527:Chl1 UTSW 6 103711201 missense probably damaging 1.00
R7625:Chl1 UTSW 6 103729125 missense probably damaging 1.00
R7667:Chl1 UTSW 6 103695495 missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103691652 missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103711102 missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103691674 missense probably benign 0.01
R7863:Chl1 UTSW 6 103706514 missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103690263 missense probably benign 0.22
R7998:Chl1 UTSW 6 103729289 missense probably benign 0.01
R8044:Chl1 UTSW 6 103706632 missense probably damaging 0.96
R8059:Chl1 UTSW 6 103674987 missense probably damaging 0.97
Z1177:Chl1 UTSW 6 103693096 nonsense probably null
Z1177:Chl1 UTSW 6 103697949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGACCATTCCAGTGGACATGGC -3'
(R):5'- GGGAAGGAACCATTCCAGAGTTTCG -3'

Sequencing Primer
(F):5'- TCCTCGGGATCTGAAGATCAC -3'
(R):5'- CGCTGTCCTGAAAACCTTAGAATG -3'
Posted On2013-07-30