Mutagenetix > Incidental Mutations

Incidental Mutation 'R0685:Chl1'

61116

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

038870-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R0685 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 103708542 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

Predicted Effect

probably null
Transcript: ENSMUST00000066905

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000203830

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000203912

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000205098

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gstm5	T	A	3: 107,897,319	I73N	probably damaging	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Il15	T	C	8: 82,337,559		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smc1b	T	C	15: 85,070,820	D1077G	possibly damaging	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tinag	C	A	9: 76,952,003	W441L	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Uhrf1	G	T	17: 56,310,742	V155L	probably damaging	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGACCATTCCAGTGGACATGGC -3'
(R):5'- GGGAAGGAACCATTCCAGAGTTTCG -3'

Sequencing Primer
(F):5'- TCCTCGGGATCTGAAGATCAC -3'
(R):5'- CGCTGTCCTGAAAACCTTAGAATG -3'

Posted On

2013-07-30