Incidental Mutation 'R7920:Dnm3'
ID611160
Institutional Source Beutler Lab
Gene Symbol Dnm3
Ensembl Gene ENSMUSG00000040265
Gene Namedynamin 3
SynonymsB230343F03Rik, 9630020E24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location161982453-162478034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 161992050 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 851 (R851H)
Ref Sequence ENSEMBL: ENSMUSP00000064538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074] [ENSMUST00000159763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070330
AA Change: R851H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265
AA Change: R851H

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 644 735 6.82e-33 SMART
low complexity region 738 751 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 799 812 N/A INTRINSIC
low complexity region 824 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086074
AA Change: R855H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265
AA Change: R855H

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 648 739 6.82e-33 SMART
low complexity region 742 755 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 828 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159763
SMART Domains Protein: ENSMUSP00000125356
Gene: ENSMUSG00000040265

DomainStartEndE-ValueType
PH 1 94 5.13e-2 SMART
GED 115 206 6.82e-33 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Dnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Dnm3 APN 1 162011926 missense probably damaging 1.00
IGL02444:Dnm3 APN 1 162010875 missense possibly damaging 0.46
IGL02481:Dnm3 APN 1 162010902 missense probably damaging 0.99
IGL02623:Dnm3 APN 1 162355432 missense probably damaging 0.99
IGL03132:Dnm3 APN 1 162011105 critical splice acceptor site probably null
IGL03330:Dnm3 APN 1 162320991 missense probably benign 0.00
fever UTSW 1 162321127 splice site probably null
nobel UTSW 1 162477705 missense probably damaging 1.00
splotare UTSW 1 162320987 missense probably damaging 0.98
LCD18:Dnm3 UTSW 1 162406561 intron probably benign
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0968:Dnm3 UTSW 1 162019819 splice site probably benign
R1161:Dnm3 UTSW 1 162353574 missense probably benign 0.06
R1680:Dnm3 UTSW 1 162010976 missense probably benign 0.12
R1747:Dnm3 UTSW 1 162313584 missense probably damaging 1.00
R1881:Dnm3 UTSW 1 162477948 start gained probably benign
R1997:Dnm3 UTSW 1 162353712 missense possibly damaging 0.60
R2157:Dnm3 UTSW 1 162307893 missense possibly damaging 0.95
R2270:Dnm3 UTSW 1 162477789 missense probably damaging 1.00
R2897:Dnm3 UTSW 1 162286074 splice site probably benign
R3018:Dnm3 UTSW 1 162321759 nonsense probably null
R3851:Dnm3 UTSW 1 162321127 splice site probably null
R3861:Dnm3 UTSW 1 162311405 missense possibly damaging 0.79
R3930:Dnm3 UTSW 1 162084130 missense probably damaging 1.00
R4432:Dnm3 UTSW 1 161991997 intron probably benign
R5318:Dnm3 UTSW 1 162011807 nonsense probably null
R5361:Dnm3 UTSW 1 162010902 missense probably damaging 0.99
R5606:Dnm3 UTSW 1 162286018 missense probably damaging 0.99
R5783:Dnm3 UTSW 1 162355471 missense possibly damaging 0.70
R6019:Dnm3 UTSW 1 162134501 missense probably damaging 0.99
R6072:Dnm3 UTSW 1 162011068 small deletion probably benign
R6086:Dnm3 UTSW 1 162321033 missense probably damaging 0.99
R6110:Dnm3 UTSW 1 162011068 small deletion probably benign
R6158:Dnm3 UTSW 1 162320987 missense probably damaging 0.98
R6473:Dnm3 UTSW 1 162477705 missense probably damaging 1.00
R6499:Dnm3 UTSW 1 162313595 missense probably damaging 1.00
R6702:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6703:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6739:Dnm3 UTSW 1 162477783 missense probably damaging 0.99
R6811:Dnm3 UTSW 1 162321083 missense probably damaging 0.96
R6915:Dnm3 UTSW 1 162318397 intron probably null
R6946:Dnm3 UTSW 1 162313655 missense possibly damaging 0.91
R7062:Dnm3 UTSW 1 162134491 nonsense probably null
R7067:Dnm3 UTSW 1 162320971 missense probably damaging 1.00
R7071:Dnm3 UTSW 1 162019843 missense probably damaging 0.99
R7468:Dnm3 UTSW 1 162321629 intron probably null
R7521:Dnm3 UTSW 1 162134544 missense probably damaging 1.00
R7583:Dnm3 UTSW 1 162477774 missense possibly damaging 0.93
R7667:Dnm3 UTSW 1 162011830 missense probably damaging 1.00
R7711:Dnm3 UTSW 1 161992053 missense possibly damaging 0.83
R7837:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7838:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7900:Dnm3 UTSW 1 162355371 missense probably benign 0.00
R7921:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7983:Dnm3 UTSW 1 162355371 missense probably benign 0.00
R8059:Dnm3 UTSW 1 162084139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCATGAGCAATGAAGATGAGTTG -3'
(R):5'- TACCCCGATGACTCAGAGAG -3'

Sequencing Primer
(F):5'- TTGGTGAACACATTAGTAAGACTGGC -3'
(R):5'- AGTCTGAGAGTCGCTGCAG -3'
Posted On2019-12-27