Incidental Mutation 'R7920:Zbtb43'
ID611163
Institutional Source Beutler Lab
Gene Symbol Zbtb43
Ensembl Gene ENSMUSG00000026788
Gene Namezinc finger and BTB domain containing 43
SynonymsZfp297b, 1700010E06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location33450287-33468559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33453969 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 378 (G378R)
Ref Sequence ENSEMBL: ENSMUSP00000028125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028125] [ENSMUST00000095035] [ENSMUST00000113156] [ENSMUST00000126442] [ENSMUST00000155198]
Predicted Effect probably damaging
Transcript: ENSMUST00000028125
AA Change: G378R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028125
Gene: ENSMUSG00000026788
AA Change: G378R

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
ZnF_C2H2 373 394 1.2e1 SMART
ZnF_C2H2 400 422 4.47e-3 SMART
ZnF_C2H2 428 448 2.01e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095035
AA Change: G415R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092645
Gene: ENSMUSG00000026788
AA Change: G415R

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
BTB 70 164 4.98e-25 SMART
ZnF_C2H2 410 431 1.2e1 SMART
ZnF_C2H2 437 459 4.47e-3 SMART
ZnF_C2H2 465 485 2.01e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113156
AA Change: G415R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108781
Gene: ENSMUSG00000026788
AA Change: G415R

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
ZnF_C2H2 373 394 1.2e1 SMART
ZnF_C2H2 400 422 4.47e-3 SMART
ZnF_C2H2 428 448 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126442
SMART Domains Protein: ENSMUSP00000122729
Gene: ENSMUSG00000026788

DomainStartEndE-ValueType
Pfam:BTB 23 69 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155198
SMART Domains Protein: ENSMUSP00000120989
Gene: ENSMUSG00000026788

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Zbtb43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Zbtb43 APN 2 33453759 missense probably benign 0.23
IGL01302:Zbtb43 APN 2 33454091 missense probably benign 0.19
IGL02163:Zbtb43 APN 2 33453783 missense possibly damaging 0.75
IGL03212:Zbtb43 APN 2 33454274 missense probably benign 0.07
R0084:Zbtb43 UTSW 2 33453984 missense probably damaging 1.00
R0400:Zbtb43 UTSW 2 33453897 missense probably damaging 1.00
R2136:Zbtb43 UTSW 2 33454520 missense probably damaging 1.00
R4528:Zbtb43 UTSW 2 33462325 intron probably benign
R4609:Zbtb43 UTSW 2 33454043 missense probably benign 0.21
R4856:Zbtb43 UTSW 2 33453932 missense probably damaging 1.00
R5131:Zbtb43 UTSW 2 33454766 missense probably damaging 0.99
R5984:Zbtb43 UTSW 2 33454260 missense probably benign 0.21
R6606:Zbtb43 UTSW 2 33455054 missense probably damaging 1.00
R7189:Zbtb43 UTSW 2 33462295 missense probably benign
R7837:Zbtb43 UTSW 2 33453969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCCTGTGGAAACTGTC -3'
(R):5'- AGGTGGACTTCTATGGCTCCTC -3'

Sequencing Primer
(F):5'- TCCACATAAATCTCTTTGCACAG -3'
(R):5'- CCTCCATGGAAGAGTTCTCTGGAG -3'
Posted On2019-12-27