Incidental Mutation 'R7920:Slc4a5'
ID611180
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 5
SynonymsC330016K18Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83219828-83304945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83261557 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 236 (T236S)
Ref Sequence ENSEMBL: ENSMUSP00000109533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]
Predicted Effect probably benign
Transcript: ENSMUST00000039212
AA Change: T121S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: T121S

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113899
AA Change: T121S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: T121S

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113900
AA Change: T236S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: T236S

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83285899 missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83296597 missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83299471 missense probably benign
IGL01025:Slc4a5 APN 6 83262533 missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83273040 splice site probably null
IGL01991:Slc4a5 APN 6 83263543 missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83271103 splice site probably benign
IGL02565:Slc4a5 APN 6 83299505 missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83263543 missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83272124 missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83270997 missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83261525 missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83273157 missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83277555 missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83267567 splice site probably benign
R0366:Slc4a5 UTSW 6 83295872 missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83271072 missense probably damaging 1.00
R1222:Slc4a5 UTSW 6 83280132 missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83271057 missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83265687 missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83296635 missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83273232 missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83224681 missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2176:Slc4a5 UTSW 6 83262560 missense probably damaging 0.98
R2920:Slc4a5 UTSW 6 83264387 missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83260529 missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83270969 missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83272133 missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83271017 missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83285854 missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83261415 missense probably benign 0.11
R5747:Slc4a5 UTSW 6 83271029 missense probably damaging 1.00
R5978:Slc4a5 UTSW 6 83277536 missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83226265 missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83226374 missense probably benign
R6564:Slc4a5 UTSW 6 83280060 missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83296747 critical splice donor site probably null
R7443:Slc4a5 UTSW 6 83264315 missense probably benign 0.45
R7672:Slc4a5 UTSW 6 83260535 missense probably damaging 1.00
R7690:Slc4a5 UTSW 6 83285872 missense probably damaging 1.00
R7837:Slc4a5 UTSW 6 83261557 missense probably benign 0.01
Z1177:Slc4a5 UTSW 6 83280033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACATGGGTCCAACTTGTTTG -3'
(R):5'- GCTGTGAGCCAACCATTCCTAG -3'

Sequencing Primer
(F):5'- AACTTGTTTGTTTCTCATCCAGATG -3'
(R):5'- AACCATTCCTAGGAACTACTGTG -3'
Posted On2019-12-27