Incidental Mutation 'R7920:Mbd4'
ID611181
Institutional Source Beutler Lab
Gene Symbol Mbd4
Ensembl Gene ENSMUSG00000030322
Gene Namemethyl-CpG binding domain protein 4
SynonymsMed1
Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location115840697-115853371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115849539 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 164 (N164D)
Ref Sequence ENSEMBL: ENSMUSP00000032469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000122816] [ENSMUST00000141305] [ENSMUST00000147282] [ENSMUST00000203643]
Predicted Effect probably benign
Transcript: ENSMUST00000032469
AA Change: N164D

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322
AA Change: N164D

DomainStartEndE-ValueType
MBD 66 142 1.25e-29 SMART
low complexity region 178 196 N/A INTRINSIC
PDB:1NGN|A 400 554 1e-111 PDB
SCOP:d1keaa_ 405 545 1e-23 SMART
Blast:ENDO3c 439 514 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038234
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112923
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122816
AA Change: N164D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322
AA Change: N164D

DomainStartEndE-ValueType
MBD 66 142 7.6e-32 SMART
low complexity region 178 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147282
AA Change: N143D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322
AA Change: N143D

DomainStartEndE-ValueType
MBD 45 121 1.25e-29 SMART
low complexity region 157 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203643
SMART Domains Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
Pfam:HhH-GPD 56 168 2.7e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Mbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mbd4 APN 6 115849530 missense probably damaging 0.99
IGL01545:Mbd4 APN 6 115850797 missense probably damaging 1.00
IGL01657:Mbd4 APN 6 115849637 missense probably damaging 0.99
IGL02406:Mbd4 APN 6 115849025 missense possibly damaging 0.96
E0370:Mbd4 UTSW 6 115849155 missense possibly damaging 0.91
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0538:Mbd4 UTSW 6 115849482 missense probably damaging 0.99
R2085:Mbd4 UTSW 6 115848957 missense probably benign 0.01
R4405:Mbd4 UTSW 6 115849115 missense possibly damaging 0.92
R4464:Mbd4 UTSW 6 115849502 missense probably damaging 0.99
R4780:Mbd4 UTSW 6 115849384 missense probably benign
R4782:Mbd4 UTSW 6 115845322 missense possibly damaging 0.49
R4799:Mbd4 UTSW 6 115845322 missense probably benign 0.26
R4814:Mbd4 UTSW 6 115849299 missense possibly damaging 0.85
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4976:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R5126:Mbd4 UTSW 6 115848968 unclassified probably null
R5202:Mbd4 UTSW 6 115849402 missense probably damaging 0.96
R5485:Mbd4 UTSW 6 115850718 missense probably benign 0.21
R6179:Mbd4 UTSW 6 115845425 missense probably benign 0.00
R6661:Mbd4 UTSW 6 115849155 nonsense probably null
R7008:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R7244:Mbd4 UTSW 6 115844603 missense probably benign 0.00
R7723:Mbd4 UTSW 6 115845363 missense possibly damaging 0.47
R7755:Mbd4 UTSW 6 115844585 missense probably damaging 0.99
R7837:Mbd4 UTSW 6 115849539 missense probably benign 0.20
R8032:Mbd4 UTSW 6 115844633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACTTGCAGTTCCTTTCAAAAC -3'
(R):5'- AGCCCACAAGGATTGAAGTTC -3'

Sequencing Primer
(F):5'- TGCAGTTCCTTTCAAAACAGTCAC -3'
(R):5'- GCCCACAAGGATTGAAGTTCAGATC -3'
Posted On2019-12-27