Incidental Mutation 'R7920:Olfr532'
ID611186
Institutional Source Beutler Lab
Gene Symbol Olfr532
Ensembl Gene ENSMUSG00000063823
Gene Nameolfactory receptor 532
SynonymsGA_x6K02T2PBJ9-42570051-42569122, MOR251-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140415710-140421639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140419321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 151 (I151V)
Ref Sequence ENSEMBL: ENSMUSP00000150798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073226] [ENSMUST00000213801]
Predicted Effect probably benign
Transcript: ENSMUST00000073226
AA Change: I151V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072959
Gene: ENSMUSG00000063823
AA Change: I151V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.5e-6 PFAM
Pfam:7tm_1 41 290 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213801
AA Change: I151V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Olfr532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr532 APN 7 140418915 missense probably damaging 1.00
IGL01743:Olfr532 APN 7 140419668 missense probably damaging 1.00
IGL01797:Olfr532 APN 7 140419018 missense probably damaging 1.00
IGL02291:Olfr532 APN 7 140419287 missense probably damaging 1.00
IGL02382:Olfr532 APN 7 140419603 missense possibly damaging 0.72
IGL02514:Olfr532 APN 7 140419594 missense probably damaging 1.00
IGL02600:Olfr532 APN 7 140418949 missense probably benign
IGL02613:Olfr532 APN 7 140419470 missense probably benign 0.04
R0358:Olfr532 UTSW 7 140418943 missense probably damaging 0.98
R0827:Olfr532 UTSW 7 140419467 missense probably damaging 0.99
R1464:Olfr532 UTSW 7 140419373 missense probably benign 0.01
R1464:Olfr532 UTSW 7 140419373 missense probably benign 0.01
R1539:Olfr532 UTSW 7 140419413 missense probably benign 0.26
R1691:Olfr532 UTSW 7 140418942 missense probably damaging 1.00
R2012:Olfr532 UTSW 7 140419111 missense probably damaging 1.00
R2195:Olfr532 UTSW 7 140419225 missense possibly damaging 0.49
R4519:Olfr532 UTSW 7 140419210 missense probably damaging 1.00
R6368:Olfr532 UTSW 7 140419667 nonsense probably null
R6656:Olfr532 UTSW 7 140419604 missense probably damaging 0.99
R7467:Olfr532 UTSW 7 140419374 missense probably benign
R7610:Olfr532 UTSW 7 140419553 nonsense probably null
R7795:Olfr532 UTSW 7 140419114 missense possibly damaging 0.49
R7837:Olfr532 UTSW 7 140419321 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCGCAGGATGCTGGAAATG -3'
(R):5'- GCAGCCACATTTCTTATAAGGG -3'

Sequencing Primer
(F):5'- AGCTGTAGGATATCATAGTCAACAG -3'
(R):5'- GGATGCATGACCCAAGTCTTC -3'
Posted On2019-12-27