Incidental Mutation 'R7920:Cln6'
ID611192
Institutional Source Beutler Lab
Gene Symbol Cln6
Ensembl Gene ENSMUSG00000032245
Gene Nameceroid-lipofuscinosis, neuronal 6
SynonymsD9Bwg1455e, 1810065L06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62838785-62852006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62849048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 81 (V81A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034776] [ENSMUST00000141821]
Predicted Effect probably benign
Transcript: ENSMUST00000034776
SMART Domains Protein: ENSMUSP00000034776
Gene: ENSMUSG00000032245

DomainStartEndE-ValueType
Pfam:CLN6 27 306 1.3e-167 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115675
Gene: ENSMUSG00000032245
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CLN6 1 64 1.3e-34 PFAM
Pfam:CLN6 68 189 2.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138276
Predicted Effect probably benign
Transcript: ENSMUST00000141821
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants have progressive retinal atrophy, limb paralysis, and seizures that lead to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Cln6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Cln6 APN 9 62844618 missense probably damaging 0.98
IGL01601:Cln6 APN 9 62846970 missense probably damaging 0.99
IGL02351:Cln6 APN 9 62847125 missense probably benign 0.01
IGL02358:Cln6 APN 9 62847125 missense probably benign 0.01
boost UTSW 9 62847093 missense probably damaging 1.00
R1113:Cln6 UTSW 9 62850861 missense probably damaging 1.00
R1308:Cln6 UTSW 9 62850861 missense probably damaging 1.00
R3690:Cln6 UTSW 9 62846970 missense possibly damaging 0.87
R3746:Cln6 UTSW 9 62847002 missense probably benign
R3898:Cln6 UTSW 9 62850652 missense probably damaging 1.00
R4576:Cln6 UTSW 9 62838949 missense probably benign 0.35
R4996:Cln6 UTSW 9 62850655 missense probably damaging 0.98
R5027:Cln6 UTSW 9 62847093 missense probably damaging 1.00
R6048:Cln6 UTSW 9 62844626 missense probably damaging 1.00
R7348:Cln6 UTSW 9 62849176 missense probably benign 0.14
R7450:Cln6 UTSW 9 62850630 missense probably damaging 1.00
R7565:Cln6 UTSW 9 62850757 missense possibly damaging 0.86
R7837:Cln6 UTSW 9 62849048 missense
Predicted Primers PCR Primer
(F):5'- TCTCCATGTGGAATGAAGGACAG -3'
(R):5'- TGTGCCAATGTCCACTCACC -3'

Sequencing Primer
(F):5'- GCACCAAGCCCAGAGAGG -3'
(R):5'- TGTCCACTCACCAGTAGTACAG -3'
Posted On2019-12-27