Incidental Mutation 'R7920:Pcnx4'
ID611196
Institutional Source Beutler Lab
Gene Symbol Pcnx4
Ensembl Gene ENSMUSG00000034501
Gene Namepecanex homolog 4
Synonyms1810048J11Rik, Pcnxl4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72536383-72580119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72556118 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 385 (L385M)
Ref Sequence ENSEMBL: ENSMUSP00000038916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044352]
Predicted Effect probably damaging
Transcript: ENSMUST00000044352
AA Change: L385M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038916
Gene: ENSMUSG00000034501
AA Change: L385M

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 247 264 N/A INTRINSIC
transmembrane domain 296 330 N/A INTRINSIC
transmembrane domain 368 390 N/A INTRINSIC
transmembrane domain 400 417 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
transmembrane domain 546 564 N/A INTRINSIC
transmembrane domain 577 599 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Pfam:Pecanex_C 999 1174 4.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Pcnx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pcnx4 APN 12 72579365 missense probably damaging 0.97
IGL01160:Pcnx4 APN 12 72579377 missense probably damaging 1.00
IGL01385:Pcnx4 APN 12 72573746 missense probably damaging 1.00
IGL01452:Pcnx4 APN 12 72574400 missense possibly damaging 0.79
IGL01984:Pcnx4 APN 12 72574409 missense probably benign 0.25
IGL02073:Pcnx4 APN 12 72574328 missense possibly damaging 0.92
IGL02726:Pcnx4 APN 12 72574212 missense probably benign 0.12
IGL02824:Pcnx4 APN 12 72555571 missense probably benign 0.02
R0007:Pcnx4 UTSW 12 72555579 missense possibly damaging 0.79
R0158:Pcnx4 UTSW 12 72556302 missense probably benign
R0575:Pcnx4 UTSW 12 72567236 missense probably benign 0.00
R0783:Pcnx4 UTSW 12 72575478 missense probably damaging 1.00
R1420:Pcnx4 UTSW 12 72555986 missense probably benign
R1497:Pcnx4 UTSW 12 72574400 missense probably benign 0.03
R2093:Pcnx4 UTSW 12 72579442 missense probably damaging 1.00
R2241:Pcnx4 UTSW 12 72574154 missense probably damaging 0.99
R2287:Pcnx4 UTSW 12 72575398 missense probably benign 0.05
R2418:Pcnx4 UTSW 12 72556263 missense probably damaging 1.00
R2437:Pcnx4 UTSW 12 72541813 missense probably damaging 1.00
R2509:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2510:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2512:Pcnx4 UTSW 12 72556799 critical splice acceptor site probably null
R3691:Pcnx4 UTSW 12 72573719 missense probably damaging 1.00
R3760:Pcnx4 UTSW 12 72567006 missense probably damaging 1.00
R3949:Pcnx4 UTSW 12 72556302 missense probably benign
R4065:Pcnx4 UTSW 12 72556360 critical splice donor site probably null
R4757:Pcnx4 UTSW 12 72556293 missense probably benign 0.00
R4804:Pcnx4 UTSW 12 72574202 missense probably benign 0.28
R4867:Pcnx4 UTSW 12 72573952 missense probably benign 0.01
R4879:Pcnx4 UTSW 12 72567185 missense probably damaging 1.00
R5108:Pcnx4 UTSW 12 72574081 missense probably benign 0.01
R5350:Pcnx4 UTSW 12 72579364 missense probably damaging 1.00
R5504:Pcnx4 UTSW 12 72574448 missense probably damaging 1.00
R5718:Pcnx4 UTSW 12 72567194 missense possibly damaging 0.49
R5943:Pcnx4 UTSW 12 72579458 missense probably damaging 0.99
R6195:Pcnx4 UTSW 12 72556874 missense possibly damaging 0.92
R7134:Pcnx4 UTSW 12 72566976 missense probably damaging 0.96
R7695:Pcnx4 UTSW 12 72541576 missense probably benign 0.00
R7837:Pcnx4 UTSW 12 72556118 missense probably damaging 1.00
R7850:Pcnx4 UTSW 12 72556068 missense probably benign
R7933:Pcnx4 UTSW 12 72556068 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTCGGGTTCTTACTGAGTC -3'
(R):5'- GCACCAATCTTCAGGAGCTTG -3'

Sequencing Primer
(F):5'- CTGAGTCTTAACCCAAGTGACGTG -3'
(R):5'- TTGTCATAGAATACAGACACAGCGTG -3'
Posted On2019-12-27