Incidental Mutation 'R7920:Rin3'
ID611197
Institutional Source Beutler Lab
Gene Symbol Rin3
Ensembl Gene ENSMUSG00000044456
Gene NameRas and Rab interactor 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location102283048-102390855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102368765 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 312 (T312A)
Ref Sequence ENSEMBL: ENSMUSP00000060771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056950] [ENSMUST00000133820]
Predicted Effect unknown
Transcript: ENSMUST00000056950
AA Change: T312A
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: T312A

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000133820
AA Change: T232A
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456
AA Change: T232A

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Rin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Rin3 APN 12 102373603 missense probably damaging 1.00
IGL01521:Rin3 APN 12 102369048 missense probably benign 0.00
PIT4495001:Rin3 UTSW 12 102369036 missense probably benign 0.02
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0504:Rin3 UTSW 12 102387564 nonsense probably null
R0699:Rin3 UTSW 12 102369575 missense probably damaging 0.98
R1499:Rin3 UTSW 12 102368759 missense unknown
R1733:Rin3 UTSW 12 102369330 nonsense probably null
R1743:Rin3 UTSW 12 102390096 missense possibly damaging 0.87
R2911:Rin3 UTSW 12 102373584 missense probably benign 0.43
R2961:Rin3 UTSW 12 102313046 nonsense probably null
R3153:Rin3 UTSW 12 102368541 missense unknown
R3932:Rin3 UTSW 12 102390083 missense probably damaging 0.98
R4498:Rin3 UTSW 12 102369680 missense probably damaging 1.00
R4803:Rin3 UTSW 12 102361383 intron probably benign
R4985:Rin3 UTSW 12 102368562 missense unknown
R5300:Rin3 UTSW 12 102369670 missense probably benign 0.29
R5363:Rin3 UTSW 12 102325834 missense probably damaging 0.97
R5414:Rin3 UTSW 12 102389857 nonsense probably null
R5458:Rin3 UTSW 12 102373716 missense probably damaging 0.99
R5503:Rin3 UTSW 12 102313055 missense probably benign 0.17
R5534:Rin3 UTSW 12 102387632 missense probably damaging 1.00
R5599:Rin3 UTSW 12 102389929 missense probably damaging 1.00
R5752:Rin3 UTSW 12 102313119 start gained probably benign
R5874:Rin3 UTSW 12 102389843 missense probably damaging 1.00
R6467:Rin3 UTSW 12 102369325 missense probably benign 0.06
R7250:Rin3 UTSW 12 102368634 missense unknown
R7264:Rin3 UTSW 12 102390115 missense probably benign 0.01
R7514:Rin3 UTSW 12 102369650 nonsense probably null
R7534:Rin3 UTSW 12 102350941 missense unknown
R7837:Rin3 UTSW 12 102368765 missense unknown
R7875:Rin3 UTSW 12 102369476 missense probably damaging 1.00
R7958:Rin3 UTSW 12 102369476 missense probably damaging 1.00
R8014:Rin3 UTSW 12 102361371 nonsense probably null
Z1177:Rin3 UTSW 12 102325862 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTATTTTCATCGAGGACTGCATC -3'
(R):5'- GAGCCTTCTTCAGGGGTAATGG -3'

Sequencing Primer
(F):5'- GACTGCATCCTACCGGCTGATC -3'
(R):5'- CTTCTTCAGGGGTAATGGAGGGG -3'
Posted On2019-12-27