Incidental Mutation 'R7920:Btd'
ID611203
Institutional Source Beutler Lab
Gene Symbol Btd
Ensembl Gene ENSMUSG00000021900
Gene Namebiotinidase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7920 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31641028-31668579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31666827 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 168 (S168R)
Ref Sequence ENSEMBL: ENSMUSP00000087608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090147
AA Change: S168R

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087608
Gene: ENSMUSG00000021900
AA Change: S168R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:CN_hydrolase 63 287 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit behavioral/neurological defects, weakness, bone loss, weight loss, and alopecia when fed a biotin-deprived diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Agps A T 2: 75,854,107 probably null Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,918 probably benign Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Btd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Btd APN 14 31667776 missense probably benign 0.00
IGL02728:Btd APN 14 31667362 missense probably benign 0.00
IGL02965:Btd APN 14 31667236 missense probably damaging 1.00
R1503:Btd UTSW 14 31667655 missense probably damaging 1.00
R1662:Btd UTSW 14 31666790 missense probably damaging 1.00
R1817:Btd UTSW 14 31662289 missense possibly damaging 0.95
R1868:Btd UTSW 14 31667309 missense probably benign 0.13
R2225:Btd UTSW 14 31667060 missense probably benign 0.00
R2418:Btd UTSW 14 31641136 critical splice donor site probably null
R4660:Btd UTSW 14 31667803 missense probably benign 0.00
R4727:Btd UTSW 14 31662321 missense probably benign 0.01
R4923:Btd UTSW 14 31662087 missense possibly damaging 0.92
R5703:Btd UTSW 14 31667047 nonsense probably null
R5806:Btd UTSW 14 31667512 missense probably benign
R6110:Btd UTSW 14 31641108 unclassified probably benign
R6119:Btd UTSW 14 31641108 unclassified probably benign
R6120:Btd UTSW 14 31641108 unclassified probably benign
R7019:Btd UTSW 14 31667105 missense probably damaging 1.00
R7019:Btd UTSW 14 31667106 missense possibly damaging 0.88
R7021:Btd UTSW 14 31667831 missense probably benign
R7837:Btd UTSW 14 31666827 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACAGACCTATGAGAGCTGC -3'
(R):5'- GCAAGTGAACACGCCAAACTTG -3'

Sequencing Primer
(F):5'- CAGACCTATGAGAGCTGCTTACG -3'
(R):5'- CAAACTTGCCAGCAAAGGG -3'
Posted On2019-12-27