Incidental Mutation 'R7921:Trp53bp2'
ID611219
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7921 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 182455819 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1040 (E1040G)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably damaging
Transcript: ENSMUST00000117245
AA Change: E1040G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: E1040G

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G A 10: 87,206,199 probably null Het
4930522H14Rik G A 4: 109,505,579 A181V probably damaging Het
Alk A T 17: 71,967,554 H587Q possibly damaging Het
Ascc3 A G 10: 50,728,297 Y1371C probably benign Het
Asxl1 T C 2: 153,396,813 F354S probably damaging Het
Cachd1 A T 4: 100,967,014 I551F possibly damaging Het
Cacna1e T C 1: 154,471,403 E1068G probably benign Het
Cdc27 A T 11: 104,513,004 M644K probably damaging Het
Chl1 T C 6: 103,691,674 V456A probably benign Het
Ctxn1 A G 8: 4,258,461 Y57H probably damaging Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
Dchs2 A G 3: 83,304,527 T1878A probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Dennd5a G T 7: 109,933,989 F191L probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Eif3l G A 15: 79,089,599 D405N possibly damaging Het
Espn T A 4: 152,131,281 D507V possibly damaging Het
Fam83f A T 15: 80,692,503 S452C possibly damaging Het
Fbxo22 A C 9: 55,218,367 E171D probably damaging Het
Fgl2 T C 5: 21,372,754 V13A probably benign Het
Fsip2 A G 2: 82,976,700 H1121R probably benign Het
G0s2 A T 1: 193,272,773 M1K probably null Het
Gm10093 A C 17: 78,492,018 E146A probably damaging Het
Gnptab G A 10: 88,440,392 probably null Het
Grm1 G A 10: 11,080,352 P63S probably benign Het
Grsf1 G A 5: 88,675,664 probably benign Het
Hcfc1r1 G A 17: 23,674,011 G10D probably damaging Het
Igsf11 T C 16: 39,007,203 V41A possibly damaging Het
Il17a C A 1: 20,732,127 A20E probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kmt2c A G 5: 25,294,699 M481T possibly damaging Het
Krt40 A T 11: 99,540,135 C263S possibly damaging Het
Larp1 T C 11: 58,047,714 V441A possibly damaging Het
Lrwd1 T C 5: 136,132,129 E300G probably damaging Het
Mcoln3 G T 3: 146,139,475 W475C probably damaging Het
Mdga1 A G 17: 29,839,822 I30T probably benign Het
Mmd T A 11: 90,267,607 V181D probably benign Het
Muc4 T A 16: 32,752,558 L812* probably null Het
Mycbp2 T C 14: 103,177,293 D2561G probably benign Het
Myh11 T A 16: 14,209,617 E1251V Het
Myl12a G T 17: 70,996,171 N95K probably benign Het
Myo1h A G 5: 114,328,811 probably null Het
Myrf G A 19: 10,219,619 P266S possibly damaging Het
Ncf1 A G 5: 134,222,095 V330A possibly damaging Het
Nfasc T C 1: 132,605,549 D638G probably damaging Het
Nkapl T C 13: 21,467,267 K392R possibly damaging Het
Olfr131 A G 17: 38,082,402 V192A probably benign Het
Olfr2 A T 7: 107,001,307 C184* probably null Het
Olfr914 A G 9: 38,606,412 probably benign Het
Pelo T A 13: 115,089,648 N91I probably damaging Het
Ptk2b T C 14: 66,158,401 N836D probably benign Het
Pwp2 A T 10: 78,182,944 probably null Het
Slc44a1 G A 4: 53,517,657 V127I probably benign Het
Snx13 A G 12: 35,105,175 T413A probably benign Het
Spaca7 C T 8: 12,585,696 P71S probably damaging Het
Spef2 A T 15: 9,609,551 M1296K possibly damaging Het
Suco G A 1: 161,829,321 A978V probably benign Het
Tcerg1 A G 18: 42,536,937 E494G probably benign Het
Tenm2 A G 11: 36,106,799 V821A probably benign Het
Tg T A 15: 66,693,263 D1151E probably benign Het
Ubap2 A T 4: 41,233,655 N79K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Yars2 T G 16: 16,304,521 probably null Het
Ylpm1 A G 12: 85,048,866 I1847V possibly damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7816:Trp53bp2 UTSW 1 182448695 missense probably damaging 0.99
R7838:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTCACTACGCGGAGGTC -3'
(R):5'- AGCTCTTTAGGCACACACTC -3'

Sequencing Primer
(F):5'- CCTTGAGCCTGGAGAAACGTTTC -3'
(R):5'- CTCAGAAGCTGTGACCTAGACTG -3'
Posted On2019-12-27