Mutagenetix > Incidental Mutation

Incidental Mutation 'R0685:Il15'

61124

Institutional Source

Beutler Lab

Gene Symbol

Il15

Ensembl Gene

ENSMUSG00000031712

Gene Name

interleukin 15

Synonyms

MMRRC Submission

038870-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0685 (G1)

Quality Score

133

Status

Validated

Chromosome

Chromosomal Location

82331632-82403222 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 82337559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034148] [ENSMUST00000209363] [ENSMUST00000209573] [ENSMUST00000211565]

AlphaFold

P48346

Predicted Effect

probably benign
Transcript: ENSMUST00000034148

SMART Domains

Protein: ENSMUSP00000034148
Gene: ENSMUSG00000031712

Domain	Start	End	E-Value	Type
Pfam:IL15	33	160	8.6e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209363

Predicted Effect

probably benign
Transcript: ENSMUST00000209573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209687

Predicted Effect

probably benign
Transcript: ENSMUST00000211565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211722

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene have normal life spans but display a variety of immune system abnormalities and maternal placental defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Chl1	G	A	6: 103,708,542		probably null	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gstm5	T	A	3: 107,897,319	I73N	probably damaging	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smc1b	T	C	15: 85,070,820	D1077G	possibly damaging	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tinag	C	A	9: 76,952,003	W441L	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Uhrf1	G	T	17: 56,310,742	V155L	probably damaging	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Il15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02590:Il15	APN	8	82343283	missense	probably benign
R0306:Il15	UTSW	8	82334454	splice site	probably benign
R0638:Il15	UTSW	8	82343261	missense	probably damaging	0.99
R3012:Il15	UTSW	8	82344420	missense	probably damaging	1.00
R7089:Il15	UTSW	8	82337575	missense	probably damaging	0.98
R9499:Il15	UTSW	8	82334548	missense	probably benign	0.00
R9551:Il15	UTSW	8	82334548	missense	probably benign	0.00
R9552:Il15	UTSW	8	82334548	missense	probably benign	0.00
R9674:Il15	UTSW	8	82343309	missense	probably damaging	0.98
R9679:Il15	UTSW	8	82344465	missense	probably benign	0.05
R9720:Il15	UTSW	8	82331979	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGGATGTTCACACACTACAGCAC -3'
(R):5'- AGGGTCAGGCGGTCTCTCAATATG -3'

Sequencing Primer
(F):5'- GGGATCATTTAGTCCCATTCTAGC -3'
(R):5'- AGGCGGTCTCTCAATATGTTCTC -3'

Posted On

2013-07-30