Incidental Mutation 'R0685:Orc6'
ID 61125
Institutional Source Beutler Lab
Gene Symbol Orc6
Ensembl Gene ENSMUSG00000031697
Gene Name origin recognition complex, subunit 6
Synonyms 6720420I10Rik, Orc6l
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0685 (G1)
Quality Score 86
Status Validated
Chromosome 8
Chromosomal Location 86026261-86034907 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 86027783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 37 (S37R)
Ref Sequence ENSEMBL: ENSMUSP00000147901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131] [ENSMUST00000034132] [ENSMUST00000170141] [ENSMUST00000210146] [ENSMUST00000211396] [ENSMUST00000211597]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034131
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000034132
AA Change: S37R

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034132
Gene: ENSMUSG00000031697
AA Change: S37R

DomainStartEndE-ValueType
Pfam:ORC6 6 108 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170141
SMART Domains Protein: ENSMUSP00000126925
Gene: ENSMUSG00000031697

DomainStartEndE-ValueType
PDB:3M03|C 18 111 2e-51 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209733
Predicted Effect possibly damaging
Transcript: ENSMUST00000210146
AA Change: S37R

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211154
Predicted Effect possibly damaging
Transcript: ENSMUST00000211396
AA Change: S37R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211597
AA Change: S37R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211479
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Gene silencing studies with small interfering RNA demonstrated that this protein plays an essential role in coordinating chromosome replication and segregation with cytokinesis. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,469,337 (GRCm39) D17G probably damaging Het
Abi3bp A G 16: 56,353,316 (GRCm39) T82A possibly damaging Het
Adgre4 A C 17: 56,099,035 (GRCm39) E180D probably benign Het
Ankrd28 G A 14: 31,465,407 (GRCm39) probably benign Het
Aoc3 A G 11: 101,227,273 (GRCm39) D382G possibly damaging Het
Apob C A 12: 8,060,742 (GRCm39) R3075S probably benign Het
Aqr A G 2: 113,971,458 (GRCm39) F459S probably damaging Het
Bcr T C 10: 74,967,475 (GRCm39) W570R probably damaging Het
Bloc1s5 C T 13: 38,787,895 (GRCm39) R163K probably benign Het
Bod1 A T 11: 31,619,267 (GRCm39) N101K possibly damaging Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Chl1 G A 6: 103,685,503 (GRCm39) probably null Het
Clstn1 G A 4: 149,731,312 (GRCm39) A885T probably benign Het
Cyp3a25 G T 5: 145,935,356 (GRCm39) P87T probably damaging Het
Dync1h1 T C 12: 110,623,626 (GRCm39) V3633A probably damaging Het
Dynlt5 T C 4: 102,859,735 (GRCm39) Y96H probably damaging Het
Elp4 C A 2: 105,622,622 (GRCm39) C241F possibly damaging Het
Fat4 T A 3: 39,055,327 (GRCm39) F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 (GRCm39) H381Y possibly damaging Het
Gm10577 G T 4: 100,877,515 (GRCm39) probably benign Het
Gm9955 G T 18: 24,842,314 (GRCm39) probably benign Het
Gstm5 T A 3: 107,804,635 (GRCm39) I73N probably damaging Het
Gypa T A 8: 81,223,331 (GRCm39) probably benign Het
Hectd2 T A 19: 36,546,831 (GRCm39) V64D probably damaging Het
Igkv10-95 T A 6: 68,657,543 (GRCm39) Y20N probably benign Het
Il15 T C 8: 83,064,188 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kiz C A 2: 146,697,978 (GRCm39) probably benign Het
Lcmt2 C A 2: 120,969,721 (GRCm39) S234I probably benign Het
Lilra5 A G 7: 4,244,956 (GRCm39) probably benign Het
Lin37 T C 7: 30,255,299 (GRCm39) E187G probably damaging Het
Lrrc37 T C 11: 103,507,714 (GRCm39) probably benign Het
Mcmdc2 T A 1: 9,982,039 (GRCm39) probably null Het
Mctp1 T C 13: 76,973,918 (GRCm39) probably null Het
Mdp1 C A 14: 55,896,726 (GRCm39) G112* probably null Het
Mmp15 T C 8: 96,098,762 (GRCm39) Y530H possibly damaging Het
Mtss2 T C 8: 111,454,029 (GRCm39) probably null Het
Muc5ac T C 7: 141,361,446 (GRCm39) S1586P probably benign Het
Nap1l5 A T 6: 58,883,757 (GRCm39) C66S possibly damaging Het
Ninl G T 2: 150,781,775 (GRCm39) Q1237K possibly damaging Het
Or5p70 A T 7: 107,994,470 (GRCm39) T48S possibly damaging Het
Or9m1b T C 2: 87,836,762 (GRCm39) E111G probably damaging Het
Papss1 A C 3: 131,288,854 (GRCm39) N119H possibly damaging Het
Phf13 A T 4: 152,076,069 (GRCm39) F278I probably damaging Het
Pole2 C A 12: 69,258,187 (GRCm39) A239S probably damaging Het
Ppt2 T C 17: 34,845,546 (GRCm39) D75G probably damaging Het
Psd2 A G 18: 36,136,044 (GRCm39) D443G possibly damaging Het
Psen1 C A 12: 83,761,594 (GRCm39) S132* probably null Het
Psme4 A G 11: 30,828,415 (GRCm39) T1812A probably damaging Het
Rasgrf1 T C 9: 89,797,535 (GRCm39) probably benign Het
Reep3 A G 10: 66,857,518 (GRCm39) probably benign Het
Rexo4 A T 2: 26,848,586 (GRCm39) probably benign Het
Rnf6 A C 5: 146,148,468 (GRCm39) S183R probably damaging Het
Scai A T 2: 38,993,749 (GRCm39) M297K probably damaging Het
Scn9a A T 2: 66,313,843 (GRCm39) S1947R probably benign Het
Sema6c T C 3: 95,080,021 (GRCm39) C772R possibly damaging Het
Skint7 T C 4: 111,837,542 (GRCm39) S107P possibly damaging Het
Slc24a3 A G 2: 145,448,715 (GRCm39) N420D probably benign Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Smg7 G A 1: 152,742,399 (GRCm39) P82L probably damaging Het
Sp3 A C 2: 72,801,342 (GRCm39) F268V probably damaging Het
Srms T C 2: 180,854,426 (GRCm39) D47G probably benign Het
Ss18 A C 18: 14,784,238 (GRCm39) M150R probably damaging Het
Taf5 G A 19: 47,063,293 (GRCm39) R281Q probably benign Het
Tars1 T C 15: 11,385,259 (GRCm39) K644R probably benign Het
Tinag C A 9: 76,859,285 (GRCm39) W441L probably damaging Het
Tmtc1 T C 6: 148,312,738 (GRCm39) S244G probably benign Het
Tpr T C 1: 150,309,476 (GRCm39) V1670A possibly damaging Het
Trpv3 A G 11: 73,187,640 (GRCm39) probably benign Het
Uhrf1 G T 17: 56,617,742 (GRCm39) V155L probably damaging Het
Ush2a G A 1: 188,132,475 (GRCm39) C899Y probably damaging Het
Vmn2r115 G A 17: 23,578,249 (GRCm39) R574H probably benign Het
Vmn2r63 T C 7: 42,577,434 (GRCm39) D368G probably benign Het
Vps13a A G 19: 16,758,105 (GRCm39) V10A probably damaging Het
Wbp11 A G 6: 136,791,636 (GRCm39) probably benign Het
Zcwpw1 A G 5: 137,797,854 (GRCm39) D145G probably benign Het
Zfp607a G A 7: 27,577,901 (GRCm39) V324I probably damaging Het
Zfp618 A G 4: 63,052,011 (GRCm39) I931V probably benign Het
Zfp821 T C 8: 110,451,174 (GRCm39) V389A possibly damaging Het
Zfp976 T A 7: 42,263,141 (GRCm39) H232L probably damaging Het
Other mutations in Orc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Orc6 APN 8 86,034,272 (GRCm39) missense probably damaging 1.00
IGL02531:Orc6 APN 8 86,029,998 (GRCm39) missense probably damaging 1.00
IGL02713:Orc6 APN 8 86,034,215 (GRCm39) missense probably benign 0.00
IGL02997:Orc6 APN 8 86,032,837 (GRCm39) unclassified probably benign
R1667:Orc6 UTSW 8 86,031,914 (GRCm39) missense possibly damaging 0.94
R3619:Orc6 UTSW 8 86,026,623 (GRCm39) critical splice donor site probably null
R3810:Orc6 UTSW 8 86,026,613 (GRCm39) missense probably benign 0.05
R4707:Orc6 UTSW 8 86,029,579 (GRCm39) missense probably damaging 1.00
R4784:Orc6 UTSW 8 86,029,579 (GRCm39) missense probably damaging 1.00
R5743:Orc6 UTSW 8 86,029,585 (GRCm39) missense probably benign 0.02
R7062:Orc6 UTSW 8 86,029,537 (GRCm39) missense probably damaging 1.00
R7199:Orc6 UTSW 8 86,029,590 (GRCm39) critical splice donor site probably null
R7803:Orc6 UTSW 8 86,030,037 (GRCm39) missense possibly damaging 0.77
R7880:Orc6 UTSW 8 86,031,873 (GRCm39) missense probably benign 0.01
R9512:Orc6 UTSW 8 86,029,522 (GRCm39) missense
R9521:Orc6 UTSW 8 86,026,615 (GRCm39) missense possibly damaging 0.95
R9620:Orc6 UTSW 8 86,026,430 (GRCm39) start gained probably benign
Y5406:Orc6 UTSW 8 86,034,302 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACGCTTGGACACAGCTA -3'
(R):5'- CGGAGCCGCCAACAAGAAGATT -3'

Sequencing Primer
(F):5'- AAAGGATGTGCTTTCTAGGCCC -3'
(R):5'- GATTAAAACAAAGAAACCTCAGGGTC -3'
Posted On 2013-07-30