Incidental Mutation 'R7921:Eif3l'
ID611262
Institutional Source Beutler Lab
Gene Symbol Eif3l
Ensembl Gene ENSMUSG00000033047
Gene Nameeukaryotic translation initiation factor 3, subunit L
SynonymsD15N1e, Eif3s6ip, Eif3eip, PAF67, 0610011H21Rik, HSP-66Y
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7921 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79075179-79094405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79089599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 405 (D405N)
Ref Sequence ENSEMBL: ENSMUSP00000038839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040518
AA Change: D405N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038839
Gene: ENSMUSG00000033047
AA Change: D405N

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:Paf67 152 550 7e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G A 10: 87,206,199 probably null Het
4930522H14Rik G A 4: 109,505,579 A181V probably damaging Het
Alk A T 17: 71,967,554 H587Q possibly damaging Het
Ascc3 A G 10: 50,728,297 Y1371C probably benign Het
Asxl1 T C 2: 153,396,813 F354S probably damaging Het
Cachd1 A T 4: 100,967,014 I551F possibly damaging Het
Cacna1e T C 1: 154,471,403 E1068G probably benign Het
Cdc27 A T 11: 104,513,004 M644K probably damaging Het
Chl1 T C 6: 103,691,674 V456A probably benign Het
Ctxn1 A G 8: 4,258,461 Y57H probably damaging Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
Dchs2 A G 3: 83,304,527 T1878A probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Dennd5a G T 7: 109,933,989 F191L probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Espn T A 4: 152,131,281 D507V possibly damaging Het
Fam83f A T 15: 80,692,503 S452C possibly damaging Het
Fbxo22 A C 9: 55,218,367 E171D probably damaging Het
Fgl2 T C 5: 21,372,754 V13A probably benign Het
Fsip2 A G 2: 82,976,700 H1121R probably benign Het
G0s2 A T 1: 193,272,773 M1K probably null Het
Gm10093 A C 17: 78,492,018 E146A probably damaging Het
Gnptab G A 10: 88,440,392 probably null Het
Grm1 G A 10: 11,080,352 P63S probably benign Het
Grsf1 G A 5: 88,675,664 probably benign Het
Hcfc1r1 G A 17: 23,674,011 G10D probably damaging Het
Igsf11 T C 16: 39,007,203 V41A possibly damaging Het
Il17a C A 1: 20,732,127 A20E probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kmt2c A G 5: 25,294,699 M481T possibly damaging Het
Krt40 A T 11: 99,540,135 C263S possibly damaging Het
Larp1 T C 11: 58,047,714 V441A possibly damaging Het
Lrwd1 T C 5: 136,132,129 E300G probably damaging Het
Mcoln3 G T 3: 146,139,475 W475C probably damaging Het
Mdga1 A G 17: 29,839,822 I30T probably benign Het
Mmd T A 11: 90,267,607 V181D probably benign Het
Muc4 T A 16: 32,752,558 L812* probably null Het
Mycbp2 T C 14: 103,177,293 D2561G probably benign Het
Myh11 T A 16: 14,209,617 E1251V Het
Myl12a G T 17: 70,996,171 N95K probably benign Het
Myo1h A G 5: 114,328,811 probably null Het
Myrf G A 19: 10,219,619 P266S possibly damaging Het
Ncf1 A G 5: 134,222,095 V330A possibly damaging Het
Nfasc T C 1: 132,605,549 D638G probably damaging Het
Nkapl T C 13: 21,467,267 K392R possibly damaging Het
Olfr131 A G 17: 38,082,402 V192A probably benign Het
Olfr2 A T 7: 107,001,307 C184* probably null Het
Olfr914 A G 9: 38,606,412 probably benign Het
Pelo T A 13: 115,089,648 N91I probably damaging Het
Ptk2b T C 14: 66,158,401 N836D probably benign Het
Pwp2 A T 10: 78,182,944 probably null Het
Slc44a1 G A 4: 53,517,657 V127I probably benign Het
Snx13 A G 12: 35,105,175 T413A probably benign Het
Spaca7 C T 8: 12,585,696 P71S probably damaging Het
Spef2 A T 15: 9,609,551 M1296K possibly damaging Het
Suco G A 1: 161,829,321 A978V probably benign Het
Tcerg1 A G 18: 42,536,937 E494G probably benign Het
Tenm2 A G 11: 36,106,799 V821A probably benign Het
Tg T A 15: 66,693,263 D1151E probably benign Het
Trp53bp2 A G 1: 182,455,819 E1040G probably damaging Het
Ubap2 A T 4: 41,233,655 N79K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Yars2 T G 16: 16,304,521 probably null Het
Ylpm1 A G 12: 85,048,866 I1847V possibly damaging Het
Other mutations in Eif3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Eif3l APN 15 79076920 missense possibly damaging 0.82
IGL02457:Eif3l APN 15 79078096 missense probably benign 0.01
IGL02658:Eif3l APN 15 79076942 missense probably damaging 1.00
IGL02689:Eif3l APN 15 79086519 missense possibly damaging 0.77
IGL02797:Eif3l APN 15 79075277 missense probably benign 0.00
IGL02824:Eif3l APN 15 79075823 splice site probably null
IGL02957:Eif3l APN 15 79089828 missense probably benign 0.00
IGL03352:Eif3l APN 15 79077051 unclassified probably benign
R0528:Eif3l UTSW 15 79089609 missense probably benign 0.00
R0550:Eif3l UTSW 15 79076867 missense probably damaging 1.00
R0751:Eif3l UTSW 15 79075766 splice site probably null
R1101:Eif3l UTSW 15 79075267 missense probably damaging 1.00
R1184:Eif3l UTSW 15 79075766 splice site probably null
R1585:Eif3l UTSW 15 79084181 missense possibly damaging 0.63
R1895:Eif3l UTSW 15 79089477 missense possibly damaging 0.55
R2442:Eif3l UTSW 15 79085607 missense probably damaging 1.00
R4865:Eif3l UTSW 15 79081649 nonsense probably null
R5092:Eif3l UTSW 15 79084154 missense probably benign 0.01
R5239:Eif3l UTSW 15 79089795 missense possibly damaging 0.95
R5328:Eif3l UTSW 15 79093361 nonsense probably null
R6575:Eif3l UTSW 15 79086578 missense possibly damaging 0.67
R6624:Eif3l UTSW 15 79089929 missense probably damaging 1.00
R6875:Eif3l UTSW 15 79085560 missense probably damaging 0.99
R7484:Eif3l UTSW 15 79084136 missense probably benign 0.00
R7838:Eif3l UTSW 15 79089599 missense possibly damaging 0.91
R7841:Eif3l UTSW 15 79089579 missense probably benign 0.05
R7924:Eif3l UTSW 15 79089579 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAACACGAGACACAGTGCTG -3'
(R):5'- CTTCATCTTGTGCTTGAAGACGAG -3'

Sequencing Primer
(F):5'- ACAGTGCTGTGTGCCAG -3'
(R):5'- AACTCCTGCTCGGTGAGGTC -3'
Posted On2019-12-27