Incidental Mutation 'R7922:Trpm8'
ID611280
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Nametransient receptor potential cation channel, subfamily M, member 8
SynonymsCMR1, Trp-p8, TRPP8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location88277661-88389293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88326454 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 133 (L133Q)
Ref Sequence ENSEMBL: ENSMUSP00000108739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040210
AA Change: L133Q

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: L133Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113114
AA Change: L133Q

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: L133Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171176
AA Change: L133Q

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: L133Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88379827 missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88343287 missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88326405 missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88325488 missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88330694 critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88328250 missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88360716 missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88348051 missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88348108 missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88328148 splice site probably benign
R1183:Trpm8 UTSW 1 88348091 missense probably damaging 1.00
R1608:Trpm8 UTSW 1 88326432 missense probably benign
R1713:Trpm8 UTSW 1 88365080 missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88350856 missense possibly damaging 0.86
R1966:Trpm8 UTSW 1 88332748 splice site probably null
R2089:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88359656 missense probably benign 0.00
R2475:Trpm8 UTSW 1 88354449 missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88328196 missense probably benign 0.00
R3745:Trpm8 UTSW 1 88348327 missense probably benign 0.21
R4063:Trpm8 UTSW 1 88362005 missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88337129 missense probably benign 0.07
R4681:Trpm8 UTSW 1 88384705 missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88348188 missense probably benign 0.00
R5620:Trpm8 UTSW 1 88359651 critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88359739 missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88355280 missense probably benign 0.01
R5839:Trpm8 UTSW 1 88325506 missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88384711 makesense probably null
R5845:Trpm8 UTSW 1 88328180 missense probably benign 0.00
R5926:Trpm8 UTSW 1 88330747 missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88351415 nonsense probably null
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88306678 start gained probably benign
R6283:Trpm8 UTSW 1 88348332 missense probably benign 0.09
R6299:Trpm8 UTSW 1 88354479 missense probably damaging 1.00
R6367:Trpm8 UTSW 1 88359683 missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88361998 missense probably damaging 0.98
R6682:Trpm8 UTSW 1 88326502 missense probably damaging 0.96
R6751:Trpm8 UTSW 1 88384706 missense possibly damaging 0.63
R7057:Trpm8 UTSW 1 88362080 missense probably null 0.99
R7489:Trpm8 UTSW 1 88379759 missense possibly damaging 0.85
R7520:Trpm8 UTSW 1 88343321 missense probably benign 0.00
R7597:Trpm8 UTSW 1 88328196 missense probably damaging 0.97
R7774:Trpm8 UTSW 1 88330841 missense probably damaging 0.99
R7839:Trpm8 UTSW 1 88326454 missense possibly damaging 0.83
R7948:Trpm8 UTSW 1 88374369 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGCACCATTCAGGATTGC -3'
(R):5'- AGATGCAGTGCAGAATGACCC -3'

Sequencing Primer
(F):5'- CACTTTCCTATGAGGCTCTGGTAG -3'
(R):5'- GTGCAGAATGACCCCTGGATATTC -3'
Posted On2019-12-27