Incidental Mutation 'R7922:Insig2'
ID611281
Institutional Source Beutler Lab
Gene Symbol Insig2
Ensembl Gene ENSMUSG00000003721
Gene Nameinsulin induced gene 2
SynonymsC730043J18Rik, Insig-2, 2900053I11Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location121304353-121332589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121312320 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 84 (I84V)
Ref Sequence ENSEMBL: ENSMUSP00000003818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003818] [ENSMUST00000071064] [ENSMUST00000159085] [ENSMUST00000160688] [ENSMUST00000160968] [ENSMUST00000162582] [ENSMUST00000162790] [ENSMUST00000186915]
Predicted Effect probably benign
Transcript: ENSMUST00000003818
AA Change: I84V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000003818
Gene: ENSMUSG00000003721
AA Change: I84V

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071064
AA Change: I84V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065485
Gene: ENSMUSG00000003721
AA Change: I84V

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159085
AA Change: I84V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124345
Gene: ENSMUSG00000003721
AA Change: I84V

DomainStartEndE-ValueType
Pfam:INSIG 28 211 9.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160688
SMART Domains Protein: ENSMUSP00000123702
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 76 7.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160968
AA Change: I84V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123747
Gene: ENSMUSG00000003721
AA Change: I84V

DomainStartEndE-ValueType
Pfam:INSIG 30 211 7.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162582
SMART Domains Protein: ENSMUSP00000125046
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 28 85 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162790
AA Change: I84V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124697
Gene: ENSMUSG00000003721
AA Change: I84V

DomainStartEndE-ValueType
Pfam:INSIG 28 146 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186915
SMART Domains Protein: ENSMUSP00000140292
Gene: ENSMUSG00000003721

DomainStartEndE-ValueType
Pfam:INSIG 1 103 1.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein product encoded by gene INSIG1. Both INSIG1 protein and this protein are endoplasmic reticulum proteins that block the processing of sterol regulatory element binding proteins (SREBPs) by binding to SREBP cleavage-activating protein (SCAP), and thus prevent SCAP from escorting SREBPs to the Golgi. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Insig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Insig2 APN 1 121305947 missense probably damaging 1.00
IGL03038:Insig2 APN 1 121319674 missense probably damaging 1.00
R0037:Insig2 UTSW 1 121306920 missense probably damaging 1.00
R1458:Insig2 UTSW 1 121307156 missense probably benign 0.07
R4544:Insig2 UTSW 1 121312192 splice site probably benign
R5077:Insig2 UTSW 1 121312235 missense probably damaging 0.98
R7325:Insig2 UTSW 1 121306937 missense possibly damaging 0.82
R7839:Insig2 UTSW 1 121312320 missense probably benign 0.01
X0061:Insig2 UTSW 1 121306963 missense probably damaging 0.99
X0066:Insig2 UTSW 1 121305949 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCAACATTGAGACTGAGTGAG -3'
(R):5'- CAGCTTTCTGCAGTGTGCTG -3'

Sequencing Primer
(F):5'- CATTGAGACTGAGTGAGACCATC -3'
(R):5'- AGTGTGCTGCCACTCTCG -3'
Posted On2019-12-27