Incidental Mutation 'R7922:Plk3'
ID611292
Institutional Source Beutler Lab
Gene Symbol Plk3
Ensembl Gene ENSMUSG00000028680
Gene Namepolo like kinase 3
SynonymsCnk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location117128655-117133963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117129330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 571 (T571A)
Ref Sequence ENSEMBL: ENSMUSP00000076130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062206] [ENSMUST00000076859] [ENSMUST00000134074] [ENSMUST00000143213] [ENSMUST00000144269] [ENSMUST00000153257] [ENSMUST00000183310]
Predicted Effect probably benign
Transcript: ENSMUST00000062206
SMART Domains Protein: ENSMUSP00000052243
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 121 217 3.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076859
AA Change: T571A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076130
Gene: ENSMUSG00000028680
AA Change: T571A

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
S_TKc 63 315 2.15e-96 SMART
Pfam:POLO_box 473 534 2.7e-16 PFAM
low complexity region 554 566 N/A INTRINSIC
Pfam:POLO_box 570 638 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134074
SMART Domains Protein: ENSMUSP00000114182
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143213
Predicted Effect probably benign
Transcript: ENSMUST00000144269
SMART Domains Protein: ENSMUSP00000122605
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 118 178 1.3e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120476
Gene: ENSMUSG00000028680
AA Change: T532A

DomainStartEndE-ValueType
low complexity region 1 9 N/A INTRINSIC
S_TKc 42 294 2.15e-96 SMART
Pfam:POLO_box 435 496 5.3e-17 PFAM
low complexity region 516 528 N/A INTRINSIC
Pfam:POLO_box 532 600 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153257
SMART Domains Protein: ENSMUSP00000121768
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:BACK 33 84 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183310
SMART Domains Protein: ENSMUSP00000138230
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
BTB 29 124 1.82e-18 SMART
BACK 129 233 4.17e-8 SMART
low complexity region 260 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the highly conserved polo-like kinase family of serine/threonine kinases. Members of this family are characterized by an amino-terminal catalytic domain and a carboxy-terminal bipartite polo box domain that functions as a substrate-binding motif and a cellular localization signal. Polo-like kinases have primarily been implicated in cell cycle regulation. In mouse, this protein that has been reported to localize to the nucleolus during interphase but is undetectable during mitosis, following nucleolus dissociation during prophase. The protein relocalizes to the nucleolus just prior to cytokinesis and peak levels are detected during G1 of interphase. This gene has been implicated in regulation of entry into S phase, with RNAi-induced depletion resulting in failure to re-enter the cell cycle. Mice deficient for this gene exhibit increased weight and tumor development at advanced age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Aged mice homozygous for a null allele develop tumors in various organs at an accelerated rate while mouse embryonic fibroblasts are hypersensitive to the induction of HIF-1alpha under hypoxic conditions or by nickel and cobalt ion treatments. Homozygotes for another null allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Plk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Plk3 APN 4 117132997 nonsense probably null
IGL01647:Plk3 APN 4 117130357 missense probably damaging 1.00
IGL02516:Plk3 APN 4 117131989 missense probably damaging 0.99
IGL03340:Plk3 APN 4 117132928 missense probably damaging 0.98
PIT4283001:Plk3 UTSW 4 117133292 missense probably damaging 1.00
R0421:Plk3 UTSW 4 117133444 missense probably damaging 1.00
R1074:Plk3 UTSW 4 117131758 missense probably damaging 1.00
R1612:Plk3 UTSW 4 117131807 missense probably damaging 1.00
R3813:Plk3 UTSW 4 117133450 missense probably damaging 1.00
R3901:Plk3 UTSW 4 117133436 missense probably benign 0.13
R5232:Plk3 UTSW 4 117129120 missense probably benign 0.04
R5486:Plk3 UTSW 4 117130403 nonsense probably null
R5655:Plk3 UTSW 4 117131480 missense probably damaging 1.00
R6612:Plk3 UTSW 4 117132737 nonsense probably null
R7127:Plk3 UTSW 4 117130570 missense probably benign 0.39
R7380:Plk3 UTSW 4 117131153 missense probably benign
R7748:Plk3 UTSW 4 117131728 missense probably damaging 1.00
R7839:Plk3 UTSW 4 117129330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTCCCCGTAGAAGTTC -3'
(R):5'- TGGCTCAAAGGTAGTGGCTG -3'

Sequencing Primer
(F):5'- CGTAGAAGTTCACCTGTACACAG -3'
(R):5'- GATCTGCCCAGTGTGGA -3'
Posted On2019-12-27